ID: 1020036273

View in Genome Browser
Species Human (GRCh38)
Location 7:4964999-4965021
Sequence CATCAACAGCACCTGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020036268_1020036273 13 Left 1020036268 7:4964963-4964985 CCAGGTGGGGAAGTGAGTTCCAA No data
Right 1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG No data
1020036271_1020036273 -6 Left 1020036271 7:4964982-4965004 CCAAGCAAAGGGAACAGCATCAA No data
Right 1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020036273 Original CRISPR CATCAACAGCACCTGTAGGC AGG Intergenic
No off target data available for this crispr