ID: 1020037357

View in Genome Browser
Species Human (GRCh38)
Location 7:4972771-4972793
Sequence AAATTAGGCGGATGTCGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020037353_1020037357 -5 Left 1020037353 7:4972753-4972775 CCTCTACTAAAAATACAAAAATT 0: 4587
1: 5911
2: 5263
3: 3182
4: 3303
Right 1020037357 7:4972771-4972793 AAATTAGGCGGATGTCGTGGCGG No data
1020037351_1020037357 14 Left 1020037351 7:4972734-4972756 CCAACATGGTGAAATCCTGCCTC 0: 58
1: 3046
2: 40610
3: 94782
4: 136456
Right 1020037357 7:4972771-4972793 AAATTAGGCGGATGTCGTGGCGG No data
1020037352_1020037357 -1 Left 1020037352 7:4972749-4972771 CCTGCCTCTACTAAAAATACAAA 0: 4425
1: 171844
2: 210900
3: 122265
4: 65006
Right 1020037357 7:4972771-4972793 AAATTAGGCGGATGTCGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020037357 Original CRISPR AAATTAGGCGGATGTCGTGG CGG Intergenic
No off target data available for this crispr