ID: 1020043502

View in Genome Browser
Species Human (GRCh38)
Location 7:5022196-5022218
Sequence GACCCACGCAGAGTCCCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 14, 2: 22, 3: 54, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020043502_1020043506 -2 Left 1020043502 7:5022196-5022218 CCCGGTGGGACTCTGCGTGGGTC 0: 1
1: 14
2: 22
3: 54
4: 349
Right 1020043506 7:5022217-5022239 TCCACATGGTTTGCAACTTTGGG No data
1020043502_1020043508 -1 Left 1020043502 7:5022196-5022218 CCCGGTGGGACTCTGCGTGGGTC 0: 1
1: 14
2: 22
3: 54
4: 349
Right 1020043508 7:5022218-5022240 CCACATGGTTTGCAACTTTGGGG No data
1020043502_1020043509 12 Left 1020043502 7:5022196-5022218 CCCGGTGGGACTCTGCGTGGGTC 0: 1
1: 14
2: 22
3: 54
4: 349
Right 1020043509 7:5022231-5022253 AACTTTGGGGATTTACTAAATGG No data
1020043502_1020043505 -3 Left 1020043502 7:5022196-5022218 CCCGGTGGGACTCTGCGTGGGTC 0: 1
1: 14
2: 22
3: 54
4: 349
Right 1020043505 7:5022216-5022238 GTCCACATGGTTTGCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020043502 Original CRISPR GACCCACGCAGAGTCCCACC GGG (reversed) Intronic
900090645 1:918967-918989 AAGGCAGGCAGAGTCCCACCTGG + Intergenic
901124661 1:6920539-6920561 GCCCCACACAGAGTCCCTACTGG - Intronic
901335297 1:8443999-8444021 GGCCCACACAGAGTCCCCACTGG + Intronic
901769462 1:11522936-11522958 GACCCAGCCAGAGCCCAACCAGG + Intronic
904565367 1:31425354-31425376 CACCCACGGTGAGGCCCACCAGG - Exonic
904588182 1:31591790-31591812 GACCCCCGCAGAGCCCCACAGGG - Intergenic
905627701 1:39499252-39499274 GCCTCCCGCAGAGTCCCTCCTGG - Intronic
905668723 1:39777856-39777878 GCCTCCCGCAGAGTCCCTCCTGG + Intronic
906725881 1:48043931-48043953 GAGCCAGGCAGAGCCCCAGCTGG - Intergenic
907890954 1:58636066-58636088 GCCCCACACAGAGTCCCTACTGG + Intergenic
909105213 1:71398179-71398201 GCCCCACACAGAGTCCCTACTGG + Exonic
909357471 1:74726168-74726190 CCCCCACGCAGAGTCCCTACTGG - Intronic
909632910 1:77785914-77785936 GCCCCACACAGAGTCCCTACTGG - Intronic
909719838 1:78754851-78754873 CACCCACACAGAGTCCCCACTGG + Intergenic
910852634 1:91663770-91663792 GACCCACCCGGAGTCCCACCGGG - Intergenic
911082787 1:93949971-93949993 CACCCCCACAGAGTCCCAACTGG - Intergenic
911880836 1:103236557-103236579 CACCCACACAGAGTCCCTACTGG + Intergenic
912315552 1:108664675-108664697 GCCCCACGGAGAGGCCCACATGG + Intergenic
914346865 1:146807357-146807379 CACCCATGCAGAGTCACACATGG - Intergenic
914900542 1:151709033-151709055 GACCCACGCTGAGGCCCAGGCGG - Exonic
916207222 1:162326699-162326721 GACCCAAGAAGAGTCTGACCTGG + Intronic
916296739 1:163228151-163228173 ACCCCACACAGAGTCCCACAGGG - Intronic
916982550 1:170154308-170154330 GTCCCACACAGAGTCCCCACTGG + Intronic
917116113 1:171605481-171605503 GGCCCACCCAGAATCCCACCAGG + Intergenic
918614043 1:186523971-186523993 CACCCACACAGAGTCCCCACTGG + Intergenic
918646844 1:186915695-186915717 GACCCACCCGGAGTCCCACTGGG - Intronic
919222136 1:194642829-194642851 GCCCCACACAGAGTCCCTACGGG + Intergenic
919256238 1:195128530-195128552 GCCCCACACAGAGTCCCTCCTGG - Intergenic
920891001 1:209985612-209985634 GCCCCACACAGAGTCCCCACTGG - Intronic
920895907 1:210049224-210049246 CACCCACACAGAGTCCCTACTGG - Intronic
921074963 1:211693247-211693269 GACCTACCCAGAGTCACACCAGG + Intergenic
921594323 1:217038169-217038191 GCCCCACACAGAGTCCCTTCTGG - Intronic
922339392 1:224643477-224643499 GACCCACTCACTGTCCCACCAGG - Intronic
922690430 1:227684903-227684925 GACCCACCTGGAGTCCCACTGGG + Intergenic
923179149 1:231499249-231499271 GCCCCACGCAGAGCCCCCACTGG - Intergenic
924858730 1:247899639-247899661 GACCCACCTGGAGTCCCACCAGG - Intergenic
1063437839 10:6048918-6048940 GAGCCACGCAGAGTCCCGCAAGG - Intronic
1065347723 10:24764845-24764867 GCCCCACGCAGACTCCCTACTGG - Intergenic
1067313336 10:45136525-45136547 GACTAACGGAGAGTCCCAACCGG - Intergenic
1068580157 10:58730512-58730534 CTCCCACACAGAGTCCCAACTGG - Intronic
1068671473 10:59727780-59727802 GACCCACCCAGAGTCCCACCAGG - Intronic
1068676807 10:59777502-59777524 CCCCCACACAGAGTCCCTCCTGG - Intergenic
1069319997 10:67158028-67158050 GGCCCACCCAGAATTCCACCGGG + Intronic
1069540596 10:69291126-69291148 GTCCCAGGCAGAATGCCACCAGG + Intronic
1069700919 10:70425151-70425173 GCCCTACGCAGAGACCCACATGG - Exonic
1071217537 10:83425500-83425522 GCCCCACCCAGAGGCCGACCTGG - Intergenic
1071282564 10:84115847-84115869 GACCCACCTGGAGTACCACCAGG + Intergenic
1071942034 10:90601092-90601114 GCCCCACACAGAGTCCCTACTGG + Intergenic
1072335142 10:94391268-94391290 AACCCACCCGGAGTCCCACTGGG + Intergenic
1073880531 10:107974948-107974970 AACCCACACAGAGTCCCTACAGG - Intergenic
1075500734 10:122971472-122971494 GAGCCACTCAGAGGCTCACCAGG + Intronic
1075550378 10:123388423-123388445 GCCCCACACAGAGTCCCCACTGG + Intergenic
1075945147 10:126426315-126426337 GCAACAGGCAGAGTCCCACCAGG + Intronic
1077564597 11:3289482-3289504 GACCCACACAGAGGCCCCTCTGG - Intergenic
1077570486 11:3335299-3335321 GACCCACACAGAGGCCCCTCTGG - Intergenic
1077717972 11:4600449-4600471 AATCCACGAAGATTCCCACCCGG + Exonic
1077993351 11:7431981-7432003 GTCCCACACAGAGTCCCCACAGG + Intronic
1078059383 11:8033445-8033467 GACACACTCTGAATCCCACCAGG + Intronic
1078978622 11:16506032-16506054 GCCCCACACAGAGTCCCTGCTGG + Intronic
1079553422 11:21729842-21729864 GACCCACCCAGTGACCCAGCAGG - Intergenic
1079686244 11:23363018-23363040 GCCCCACACAGAGTCCCTACTGG - Intergenic
1079736177 11:23999717-23999739 CCCCCACACAGAGTCCCACTGGG - Intergenic
1079916216 11:26371443-26371465 CCCCCACACAGAGTCCCACTGGG + Intronic
1080153394 11:29078867-29078889 GCCCCACACAGAGTCCCTACTGG + Intergenic
1082229403 11:49745108-49745130 GCCCCACACAGAGTCCCCACTGG - Intergenic
1083081905 11:60102698-60102720 GACCCATCCAGAGTCCCACCGGG - Intergenic
1083090220 11:60191855-60191877 AACCCACCCAGAGTACCACCAGG + Intergenic
1083197508 11:61097508-61097530 GACCCACCCGGAGTCCCACCAGG + Intergenic
1084412653 11:69013379-69013401 GCCCCCCCCAGAGCCCCACCGGG + Exonic
1084798519 11:71525874-71525896 GGCCCACACAGAGTCCCCACTGG + Intergenic
1085240069 11:75045804-75045826 GGCCCACCCAGAGTCCCACCAGG + Intergenic
1085588239 11:77731928-77731950 GAGCCACACAGAGTCCCTACTGG + Intronic
1085861845 11:80244388-80244410 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1086309351 11:85519126-85519148 GCCCCACACAGAGTCCCTACTGG + Intronic
1086765852 11:90694120-90694142 TACCCACACAGAGTCCCCACTGG + Intergenic
1086973128 11:93104846-93104868 GACCCACCCGGAGTCCCACCAGG - Intergenic
1086995711 11:93353497-93353519 CACCCACACAGAGTCCCTACTGG - Intronic
1087433361 11:98081274-98081296 TCCCCACACAGAGTCCCAACTGG + Intergenic
1087541924 11:99531950-99531972 AACCCACACAGAGTCCCTTCTGG + Intronic
1087684854 11:101250970-101250992 GACCCACCTGGAGTCCCACCAGG + Intergenic
1089090315 11:115869379-115869401 GGCCCAAGGAGAGGCCCACCTGG - Intergenic
1091814173 12:3423695-3423717 GACCCACCCAGAGTCCCACTGGG - Intronic
1092099463 12:5871247-5871269 GGCCCAAGCAGAATCCCTCCTGG + Intronic
1092570326 12:9714461-9714483 GGCCCACCCAGAATTCCACCAGG - Intergenic
1093027553 12:14258663-14258685 CACACACACAGTGTCCCACCAGG - Intergenic
1093593772 12:20938358-20938380 GACCCACCTGGAGTCCCACCGGG - Intergenic
1094379841 12:29831014-29831036 GCCCCACACAGAGTCCCCACTGG - Intergenic
1095765155 12:45886520-45886542 GCCCCACACAGAGTCCCCACTGG - Intronic
1097481055 12:60126423-60126445 GCCCCACACAGAGTCCCTACTGG + Intergenic
1097554082 12:61115690-61115712 TCCCCACACAGAGTCCCACTGGG + Intergenic
1097999127 12:65922123-65922145 CCCCCACACAGAGTCCCAACTGG + Intronic
1098248731 12:68546631-68546653 GACCCACCTGGAGTCCCACTGGG + Intergenic
1098639241 12:72819654-72819676 GGCCCACCCAGAGTTCCACCAGG - Intergenic
1098748978 12:74271711-74271733 GACCCACCCGGAGTCCCAACGGG + Intergenic
1099846144 12:88031017-88031039 CCCCCACACAGAGTCCCTCCTGG - Intronic
1100123441 12:91395363-91395385 GCCCCACACAGAGTCCCCACTGG + Intergenic
1101028185 12:100634366-100634388 GATCCACCCAGAGTCCCACCGGG - Intergenic
1101257937 12:102998063-102998085 GCCCCACACAGAGTCCCTACTGG - Intergenic
1101359052 12:104009056-104009078 CCCCCACGCAGAGTCCCTACTGG + Intronic
1101416678 12:104514432-104514454 GACCCCCACAGAGTCTCACATGG - Intronic
1101581563 12:106046730-106046752 TACCCAGGCAGAGTCCCAGGTGG + Intergenic
1103649201 12:122420495-122420517 TACCTACCCAGGGTCCCACCCGG + Intronic
1104808027 12:131601860-131601882 GCCCCACACAGAGTCCCCACTGG - Intergenic
1105811725 13:24001608-24001630 GACCCTAGCAGAGACCCACCAGG + Intronic
1109803325 13:67404574-67404596 GACCCACCCGGAGTCCCACCGGG + Intergenic
1109910595 13:68905747-68905769 GCCCCACACAGAGTCCCCACTGG + Intergenic
1110511464 13:76356003-76356025 GCCCCACACAGAGTCCCTACTGG + Intergenic
1111715771 13:91877205-91877227 GCCCCACACAGAGTCCCTACTGG + Intronic
1111770024 13:92585082-92585104 ACCCCACACAGAGTCCCTCCTGG + Intronic
1112252208 13:97792722-97792744 GCCCCACACAGAGTCCCCACTGG - Intergenic
1113850198 13:113413501-113413523 GAGACACGCAGAGCCCCACGCGG - Intergenic
1114139707 14:19895646-19895668 GACCAACACAGAGAGCCACCTGG - Intergenic
1116127029 14:40800907-40800929 CACCCACACAGAGTCCCTACCGG - Intergenic
1116240727 14:42339063-42339085 GACCCACCCGGAGTCCCACCGGG - Intergenic
1116420110 14:44722560-44722582 GCCCCACACAGAGTCCCTACTGG + Intergenic
1117176512 14:53152273-53152295 GACCCAAGGAGAGTGCTACCCGG - Exonic
1117447742 14:55820875-55820897 GACCCACCTGGAGTCCCATCGGG - Intergenic
1118603023 14:67483595-67483617 GATCCACACAGAGGCCCTCCAGG + Intronic
1119200575 14:72748980-72749002 CCCCCACACAGAGTCCCACCTGG + Intronic
1119699295 14:76742176-76742198 GGCCCATGGAGAGGCCCACCTGG - Intergenic
1119898831 14:78243153-78243175 GGCCCAGGCAGAGCCCCAGCAGG - Intronic
1122116037 14:99527730-99527752 GACCCAGGCAGCTTCCCACCGGG + Intronic
1122831922 14:104402414-104402436 GCCCCACACAGAGTCCCCACTGG + Intergenic
1123118799 14:105907579-105907601 GACAGACCCACAGTCCCACCTGG - Intergenic
1124118468 15:26868096-26868118 GACCCCCACAGAGGCTCACCAGG - Intronic
1124888574 15:33710554-33710576 GCTCCATGCAGAGTCCCTCCTGG - Intronic
1125279299 15:38027061-38027083 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1126648037 15:50894662-50894684 GCCCCACACAGAGTCCCTACTGG + Intergenic
1127095939 15:55512344-55512366 GACCCACCTGGAGTCCCACTAGG - Intergenic
1127753346 15:62067622-62067644 GACCCAAGCGGAGTCGCTCCAGG - Exonic
1128450859 15:67805215-67805237 GACCCACGCAGGGTGTCCCCAGG + Intronic
1129393807 15:75233684-75233706 GTCCCAGGCAGGGCCCCACCTGG - Intergenic
1130824760 15:87532692-87532714 CTCCCACACAGAGTCCCTCCTGG - Intergenic
1131468186 15:92672603-92672625 GACCCAGGCACTGCCCCACCTGG + Intronic
1131726798 15:95235163-95235185 GAGCCACACAGAGTCCCCACTGG - Intergenic
1132205896 15:99985955-99985977 GGCCCATGCTGAGTCCCACTGGG - Intronic
1133008300 16:2896695-2896717 GACCCACCCCGAGGCCCAGCGGG + Exonic
1134192649 16:12134506-12134528 GCCCCACGGAGAGGCCCACGTGG - Intronic
1134523885 16:14930260-14930282 GATCCGCCCAGAGTCCCTCCAGG + Intronic
1134549019 16:15130675-15130697 GATCCGCCCAGAGTCCCTCCAGG - Intronic
1134711476 16:16328745-16328767 GATCCGCCCAGAGTCCCTCCAGG + Intergenic
1134719327 16:16372044-16372066 GATCCGCCCAGAGTCCCTCCAGG + Intergenic
1134948099 16:18339841-18339863 GATCCGCCCAGAGTCCCTCCAGG - Intergenic
1134955353 16:18379948-18379970 GATCCGCCCAGAGTCCCTCCAGG - Intergenic
1137041384 16:35615942-35615964 GACCCACCTGGAGTCCCACCAGG - Intergenic
1139987116 16:70907913-70907935 CACCCATGCAGAGTCACACATGG + Intronic
1142141866 16:88476142-88476164 GAGCCAGGCTGAGTCCCACCTGG - Intronic
1142668846 17:1478053-1478075 GGCCCACGGAGAGTGCCCCCAGG + Intronic
1142883987 17:2901430-2901452 GACCCACCCAGGGACCCACAAGG - Intronic
1143155875 17:4835687-4835709 AACCCAAGCAGAGTCCCACAAGG - Intronic
1146098386 17:29954656-29954678 CCCCCACGCAGAGTCCCTGCTGG + Intronic
1146764495 17:35507027-35507049 GACCCACCCAGAGTCCCACCAGG + Intronic
1147637557 17:41973393-41973415 GACCCAGGGAGGGTCCCTCCTGG - Intronic
1147809982 17:43161560-43161582 GGCCCACCCAGAATCCCACCGGG - Intergenic
1148563860 17:48621647-48621669 GACCCACGCAGAGAAGCCCCGGG - Exonic
1148828633 17:50414008-50414030 AACCCACCCGGAGTCCCACTGGG - Intergenic
1151919819 17:77145824-77145846 GAGCCAGGCACAGTCCCACAGGG - Intronic
1152455285 17:80412183-80412205 AACCCACCCGGAGTCCCACAGGG + Intergenic
1152514232 17:80812965-80812987 GAGCCACATAGAGTCCCAGCTGG - Intronic
1152861581 17:82699153-82699175 GACCGACCCCGAGCCCCACCCGG - Intergenic
1155221640 18:23690298-23690320 CACCCACGGAGCGTCCCGCCAGG + Intronic
1157377850 18:47182553-47182575 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1158292426 18:55956641-55956663 GACCCACCCAGAGTCCCACCGGG + Intergenic
1159756356 18:72370855-72370877 CCCCCACACAGAGTCCCAACTGG + Intergenic
1160727856 19:625457-625479 GAACCTCCCACAGTCCCACCTGG - Intronic
1160918635 19:1509553-1509575 CACCCCCGCAGAGGCCCACTAGG - Intronic
1161465643 19:4428848-4428870 GACCCACGCACGTTTCCACCCGG + Exonic
1163878408 19:19896476-19896498 GACCCACCTGGAGTCCCACCGGG + Intergenic
1163942878 19:20511190-20511212 GACCCACCCAGAGTCCCACCAGG - Intergenic
1164216575 19:23155841-23155863 GACCCACCCGGAGTCCCACCAGG - Intergenic
1166084670 19:40467042-40467064 GGCCCACGCGCAGTCACACCCGG - Intronic
1166991240 19:46693985-46694007 GGCCCACCCGGAGTCCCGCCAGG + Exonic
1168137603 19:54361657-54361679 GTCCCACACTCAGTCCCACCCGG - Intronic
1168160466 19:54507421-54507443 GTCCCACACTCAGTCCCACCCGG + Intronic
1168425857 19:56238069-56238091 GACACACACAGAGACACACCCGG + Intronic
926491112 2:13527276-13527298 GACCCACCCAGAGTCCCACCGGG - Intergenic
926769038 2:16351660-16351682 CCCCCACACAGAGTCCCACTGGG + Intergenic
928092403 2:28383031-28383053 AACACACGCAGAGTGCAACCAGG - Intergenic
928465604 2:31519832-31519854 GACCCACACAGAGTCCCTACTGG + Intergenic
928626742 2:33147675-33147697 GTCTCAGGCAGAGTCCTACCAGG + Intronic
929358146 2:41050953-41050975 GTCCCACACAGAGTCCCTACTGG + Intergenic
931162218 2:59704465-59704487 CCCCCACACAGAGTCCCACTGGG - Intergenic
932912255 2:75818211-75818233 GCCCCACACAGAGTCCCTACTGG - Intergenic
933521587 2:83381196-83381218 GCCCCACACAGAGTCCCCACTGG + Intergenic
935638079 2:105265822-105265844 GACCCACTTAGAGTCCCAAAAGG + Exonic
935721154 2:105980416-105980438 GACCCACCCGGAGTCCCACCAGG - Intergenic
935970910 2:108530120-108530142 GACCCACCCGGAGTCCCACCGGG + Intergenic
936419226 2:112347451-112347473 GACCCACCCAGAGTCCCACCGGG - Intergenic
936734735 2:115427262-115427284 CTCCCACACAGAGTCCCAGCTGG - Intronic
936822705 2:116542495-116542517 CCCCCACACAGAGTCCCACTGGG - Intergenic
936909402 2:117574951-117574973 CACCCACACAGAGTCCCCACTGG - Intergenic
939137602 2:138315489-138315511 CCCCCACACAGAGTCCCTCCTGG - Intergenic
939174761 2:138736184-138736206 CCCCCACACAGAGTCCCAACTGG - Intronic
939694922 2:145312129-145312151 CCCCCACGCAGAGTCCCTACTGG - Intergenic
940484117 2:154275681-154275703 CCCCCACACAGAGTCCCCCCTGG + Intronic
940485233 2:154288939-154288961 CCCCCACACAGAGTCCCCCCTGG - Intronic
940825641 2:158409172-158409194 CCCCCACGCAGAGTCCCTACTGG + Intronic
941477600 2:165968238-165968260 GCCCCACACAGAGTCCCTACTGG + Intergenic
944307437 2:198194281-198194303 TCCCCACACAGAGTCCCCCCTGG - Intronic
1168768372 20:397442-397464 GTCCCCAGAAGAGTCCCACCTGG - Exonic
1169028307 20:2387942-2387964 GGCCCACGGAGAATCTCACCTGG - Intronic
1170400824 20:15981215-15981237 GGCCCACCCAGAATTCCACCAGG - Intronic
1171239236 20:23551639-23551661 CACAGACTCAGAGTCCCACCTGG - Intergenic
1171490695 20:25515012-25515034 GGCCCACCCAGAGTCCCCACTGG + Intronic
1175889458 20:62309906-62309928 ACCCCACCCAGAGTCCCGCCTGG + Intronic
1176020430 20:62959851-62959873 TCCCCTCGCAGAGTCCCTCCAGG + Intronic
1176146072 20:63566094-63566116 GACCCGCGCCCAGTCCCAGCTGG - Exonic
1177139715 21:17344886-17344908 GACCCACACAGAGTCCCTACTGG + Intergenic
1177236109 21:18391713-18391735 CCCCCACACAGAGTCCCCCCTGG - Intronic
1177602697 21:23336291-23336313 CCCCCACACAGAGTCCCACTAGG + Intergenic
1178448052 21:32663423-32663445 GACCCATCCGGAGTCCCACCAGG + Intronic
1179316395 21:40247785-40247807 GCCCCACACAGAGTCCCTACTGG - Intronic
1179670567 21:42944073-42944095 GACCCACCCGGAGTCCCACCAGG - Intergenic
1179932379 21:44579171-44579193 GTCCCACCCACTGTCCCACCTGG - Intronic
1179937242 21:44613470-44613492 AACCCACCCACTGTCCCACCTGG + Intronic
1180595229 22:16968584-16968606 TACCCACACAGTGTCCCTCCTGG + Intronic
1181051924 22:20241964-20241986 GAGCCAGGCAGAGTCCCAAAGGG + Exonic
1181343846 22:22203080-22203102 GACCCATGCAGAGATCCACATGG - Intergenic
1181812685 22:25413540-25413562 GCCCCACACAGAGTCCCCACTGG - Intergenic
1183542286 22:38436431-38436453 GAACCAAGCCGAGTCCCACTTGG + Intronic
1184151253 22:42640326-42640348 GAACCACGCAGGGTCCTTCCGGG - Exonic
1185332186 22:50256793-50256815 CACCCAGGCAGGTTCCCACCAGG + Intronic
949612309 3:5715405-5715427 TACCCCCACAGTGTCCCACCAGG + Intergenic
950468525 3:13170403-13170425 GTCCCACACAGAGTCCCTACTGG + Intergenic
951165719 3:19483242-19483264 GACCTACCTGGAGTCCCACCAGG - Intronic
951189304 3:19749734-19749756 GACCCACACAGAGAGCCACGTGG - Intergenic
952096498 3:29960525-29960547 TTCCCACACAGAGTCCCCCCTGG - Intronic
952185210 3:30961039-30961061 CCCCCACACAGAGTCCCACTGGG - Intergenic
952715049 3:36471948-36471970 GTCCCACACAGAGTCCCTACTGG - Intronic
954911833 3:54117238-54117260 CCCCCACACAGAGTCCCACTGGG + Intergenic
956238594 3:67104134-67104156 GACCCATGCAGAGTCCCCACTGG + Intergenic
956911414 3:73821747-73821769 AACCCACACAGAGTCCCCACTGG + Intergenic
957406551 3:79779654-79779676 GACCCACCAGGAGTCCCACAGGG + Intergenic
957676752 3:83377320-83377342 CCCCCACACAGAGTCCCAACTGG - Intergenic
957999580 3:87734891-87734913 GGCCCACCCAGAATCCCACTGGG - Intergenic
958553290 3:95643392-95643414 GTCCCACACAGAGTTCCAACTGG - Intergenic
958684743 3:97378422-97378444 CCCCCACGCAGAGTCCCTCCCGG + Intronic
959031797 3:101308264-101308286 GCCCCACACAGAGTCCCCACTGG - Intronic
959815665 3:110670906-110670928 CACCCACACAGAGTCCCTACTGG + Intergenic
959968425 3:112381690-112381712 GCCCCACACAGAGTCCCTACTGG + Intergenic
960494161 3:118355085-118355107 GACCCCCACAGAGTCCCCCCAGG + Intergenic
961459887 3:127043455-127043477 GCCCCACTCAGAGCCCCACTGGG - Intergenic
961667836 3:128504620-128504642 GATCCATGGAGAGTCCAACCTGG + Intergenic
962096426 3:132297390-132297412 GGCCCACCCAGAATCCCACTGGG - Intergenic
962277381 3:134026304-134026326 GACCCACCCGGAGTCCCACCGGG + Intronic
963226347 3:142866350-142866372 GACTTACGCAGAGGCCCTCCTGG + Intronic
963421022 3:145061266-145061288 GCCCCACACAGAGTCCCTACTGG - Intergenic
964522063 3:157580540-157580562 GACCCACCTGGAGTCCCACCGGG - Intronic
964924353 3:161937770-161937792 GACCCACCTGGAGTCCCACCAGG + Intergenic
964932672 3:162045842-162045864 GACCCACCCGGAGTCCCACTGGG - Intergenic
964932678 3:162045854-162045876 GACCCACCCAGAGACCCACCCGG - Intergenic
965049446 3:163626823-163626845 GCCCCACACAGAATCCCAACTGG + Intergenic
965864087 3:173183519-173183541 CACCCACACAGAGTCCCTTCTGG + Intergenic
966868538 3:184275970-184275992 GCCCCACGCGGAGCCCCGCCCGG - Intronic
967908335 3:194520284-194520306 TCCCCACACAGAGTCCCAACTGG + Intergenic
967933562 3:194708275-194708297 GCCCCATACAGAGTCCCTCCTGG - Intergenic
968503985 4:963622-963644 GTGCCACGCAGAGTCCCACGTGG - Intronic
968660267 4:1795877-1795899 GAACCACCCAGAGGCCCACGCGG - Intronic
969194655 4:5551110-5551132 CACCCACACAGAGTCCCTACTGG + Intronic
970061543 4:12039551-12039573 TACCCACACAGAGTCCCCACTGG + Intergenic
971024031 4:22570754-22570776 GGCCCAAGGAGAGGCCCACCTGG - Intergenic
971211458 4:24621731-24621753 GACCCACCGGGAGTCCCATCTGG - Intergenic
971753341 4:30678507-30678529 GCCCCATGCAGAGTCCCTACTGG + Intergenic
972051658 4:34742918-34742940 GCCCCACACAGAGTCCCCACTGG - Intergenic
972217369 4:36912013-36912035 GACCCATCTAGAGTCCCACCGGG + Intergenic
972990896 4:44821622-44821644 GACCCACCCGGAGTCCCACCGGG - Intergenic
974394998 4:61322888-61322910 GCCCCACACAGAGTCCCTACTGG - Intronic
974797123 4:66767033-66767055 GCCCCACACAGAGTCCCTACTGG + Intergenic
975205992 4:71644650-71644672 GACCCACCCAGAGTCCCACCGGG + Intergenic
975456508 4:74597429-74597451 CACCCACACAGAGTCCCCACTGG + Intergenic
976051143 4:81012576-81012598 GCCCCACACAGAGTCCCTACTGG + Intergenic
976060662 4:81124581-81124603 GTCCCAGGAAGAGGCCCACCTGG + Intronic
976461170 4:85314413-85314435 GCCCCACACAGAGTCCCTACTGG - Intergenic
976990023 4:91354457-91354479 GGCCCACCCAGAATTCCACCAGG - Intronic
977043222 4:92039756-92039778 GACGCACTCAGAGTCCCACTGGG - Intergenic
977592500 4:98842302-98842324 CCCCCACACAGAGTCCCTCCTGG + Intergenic
978314325 4:107418733-107418755 GACACACTTAGAGTCCCACAGGG + Intergenic
978939103 4:114415682-114415704 GCCCCACACAGAGTCCCTACTGG + Intergenic
979177168 4:117679425-117679447 TCCCCACACAGAGTCCCACTGGG + Intergenic
979391879 4:120138016-120138038 CCCCCACACAGAGTCCCTCCTGG - Intergenic
980525673 4:133988748-133988770 CACCCACACAGGGTCCCAACTGG - Intergenic
980646132 4:135644369-135644391 GCCCCACACAGAGTCCCTACTGG + Intergenic
981483351 4:145259885-145259907 GCCCCACACAGAGTCCCTACCGG - Intergenic
983039307 4:162906299-162906321 GCCCCATGCAGAGTCCCCACTGG - Intergenic
983298012 4:165890831-165890853 CACCCACACAGAGTCCCCACTGG - Intronic
983898298 4:173104913-173104935 GACCCACCCGGAGTCCCACTGGG + Intergenic
985159984 4:187034313-187034335 GCCCCACACAGAGTCCCTACTGG + Intergenic
985220330 4:187697147-187697169 GTCCCACACAGAGTCCCCACTGG + Intergenic
986258687 5:6123787-6123809 GCCCCACACAGAGTCCCTGCTGG - Intergenic
986900210 5:12421927-12421949 GCCCCACACAGAGTCCCCACTGG + Intergenic
987478933 5:18428616-18428638 GTCCCACACAGAGTCCCTACTGG + Intergenic
988016197 5:25563262-25563284 GCCCCATACAGAGTCCCAACTGG - Intergenic
988876977 5:35457519-35457541 GCCCCACACAGAGTCCCCACTGG + Intergenic
989095706 5:37779378-37779400 GACCAACCTGGAGTCCCACCGGG - Intergenic
989557900 5:42818441-42818463 GGCCCACCCAGAATTCCACCGGG + Intronic
989656746 5:43753282-43753304 GTCCCACACAGAGTCCCTACTGG - Intergenic
990077856 5:51873283-51873305 CCCCCACACAGAGTCCCAACTGG + Intergenic
991009940 5:61872030-61872052 GTCCCACACAGAGTCCCTACTGG - Intergenic
991675838 5:69089159-69089181 GACCCACCTGGAGTCCCACTGGG - Intergenic
991776380 5:70089653-70089675 GCCCCACGCAGAGTCCCTACTGG + Intergenic
991855667 5:70965100-70965122 GCCCCACGCAGAGTCCCTACTGG + Intergenic
991869681 5:71097878-71097900 GCCCCACGCAGAGTCCCTACTGG + Intergenic
993752845 5:91691912-91691934 GCCCCACACAGAGTCCCCACTGG - Intergenic
994655938 5:102593243-102593265 CACCCACACAGAGTCCCTACTGG - Intergenic
995009409 5:107240659-107240681 TCCCCACACAGAGTCCCAACTGG + Intergenic
995474162 5:112531309-112531331 GACCCACCCGGAGTCCCACCGGG + Intergenic
997692889 5:135838912-135838934 GTCCCACACAGAGTCCCCACTGG + Intronic
998115012 5:139530203-139530225 GGCCCACCCAGAATTCCACCAGG + Intronic
998487719 5:142517525-142517547 TACCCACACAGAGTCCCCACTGG + Intergenic
999518402 5:152324205-152324227 GACCCATGCAGATTCACCCCTGG - Intergenic
1000237137 5:159372533-159372555 AACCCACCCGGAGTCCCACCAGG + Intergenic
1002407818 5:179049870-179049892 GACCCACCCAGAATTCCACCGGG - Intergenic
1002998781 6:2311725-2311747 AACCCACTTGGAGTCCCACCGGG - Intergenic
1004805697 6:19201645-19201667 CCCCCACGCAGAGTCCCCACTGG - Intergenic
1005462264 6:26080403-26080425 GACCCACCCAGAGTCCCACCGGG + Intergenic
1006570852 6:35002938-35002960 AGCCCACCCAGAATCCCACCAGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1008123811 6:47646805-47646827 GACCCACCTGGAGTCCCATCGGG + Intergenic
1010145790 6:72668451-72668473 CACACACACAGAGTCCCAACAGG - Intronic
1010555591 6:77275187-77275209 CACCCACACAGAGTCCCTACTGG + Intergenic
1010909519 6:81536434-81536456 GCCCCACACAGAGTCCCCACTGG - Intronic
1011032160 6:82935349-82935371 GACCCAAACAGCCTCCCACCAGG + Intronic
1011348723 6:86399672-86399694 GCCCCACACAGAGTCCCCTCTGG - Intergenic
1011382749 6:86760210-86760232 CACCCACACAGAGTCCCCACTGG + Intergenic
1011565719 6:88669623-88669645 GGCCCATCCAGAGTCTCACCAGG + Intronic
1012700498 6:102451246-102451268 GTCCCACGTAGAGTCCCTACTGG - Intergenic
1012780061 6:103546613-103546635 CCCCCACACAGAGTCCCCCCTGG - Intergenic
1013558979 6:111285514-111285536 GGCCCACCCAGAATTCCACCAGG - Intergenic
1014546559 6:122742830-122742852 GACCCACCCAGAGTCCCACCAGG - Intergenic
1015045164 6:128768058-128768080 TACCCACACAGAGTCCCCACTGG - Intergenic
1015172250 6:130266620-130266642 GATCCTCCCAGAGTCCCACCGGG + Intronic
1016241266 6:141934460-141934482 CCCCCACACAGAGTCCCAACTGG + Intergenic
1016261311 6:142174060-142174082 ATCCCACACACAGTCCCACCTGG + Intronic
1016281756 6:142426636-142426658 GCCCCACACAGAGTCCCTACTGG - Intronic
1016587747 6:145708729-145708751 CACCCACACAGAGTCCCCACTGG + Intronic
1017525364 6:155237474-155237496 GCCCCACACAGAGTCCCTACTGG - Intronic
1018711069 6:166498529-166498551 GACACACGCAGAGTGCCGACTGG - Exonic
1019039383 6:169091021-169091043 GCCCCACACAGAGTCCCCACTGG + Intergenic
1019527875 7:1488906-1488928 ATCCCACGCAGGGTCACACCTGG + Intronic
1020043502 7:5022196-5022218 GACCCACGCAGAGTCCCACCGGG - Intronic
1020780928 7:12516471-12516493 GCCCCACACAGAGTCCCCACTGG + Intergenic
1021036818 7:15809821-15809843 CACCCACACAGAGTCCCTACTGG - Intergenic
1021849111 7:24790588-24790610 GACCCACCTGGAGTCCCACCGGG - Intergenic
1024373300 7:48610539-48610561 CACCCACACAGAGTCCCCACTGG - Intronic
1024814875 7:53256985-53257007 CACCCACACAGAGTCCCTACTGG + Intergenic
1027513307 7:79110255-79110277 GCCCCACACAGAGTCCCCACTGG + Intronic
1027626031 7:80545758-80545780 GCCCCACACAGAGTCCCTACTGG + Intronic
1028359991 7:89955894-89955916 CCCCCACACAGAGTCCTACCAGG - Intergenic
1029486420 7:100845220-100845242 GGCCCACCCAGAATCCCACCAGG + Intronic
1029822159 7:103156973-103156995 GACCCACCTGGAGTCCCACCGGG + Intergenic
1030111726 7:106032497-106032519 GCCCCACGCAGAGTCACTGCTGG + Exonic
1030970073 7:116045675-116045697 CCCCCACACAGAGTCCCTCCTGG + Intronic
1031282227 7:119818899-119818921 GCCCCACACAGAGTCCCCACTGG + Intergenic
1031652088 7:124303615-124303637 TTCCCACACAGAGTCCCACTGGG + Intergenic
1032394703 7:131581232-131581254 CACCCAGGCAGAGGCCAACCAGG + Intergenic
1032561007 7:132892992-132893014 CCCCCACGCAGAGTCCCTACTGG + Intronic
1032979325 7:137263860-137263882 AGCCCACCCAGAATCCCACCGGG - Intronic
1033031575 7:137832234-137832256 CCCCCACTCAGAGTCCCTCCTGG - Intronic
1034728793 7:153365489-153365511 GACCCACACAGAATCCCCACTGG - Intergenic
1035041194 7:155928816-155928838 AAGCCACGCCCAGTCCCACCCGG + Intergenic
1035674001 8:1442230-1442252 GACCCAGGCATAGACCCGCCAGG + Intergenic
1036163182 8:6407188-6407210 GACCCCCTCTGAGGCCCACCTGG + Intronic
1037949089 8:23007184-23007206 CACCCACCCAGAGGACCACCAGG + Exonic
1039419660 8:37425551-37425573 GATCCACAGAGAGTCCCAGCAGG + Intergenic
1039614155 8:38941619-38941641 AACACAGGCAGTGTCCCACCTGG - Intronic
1039876669 8:41592294-41592316 GACCCACCTGGAGTCCCACCGGG - Intronic
1041515794 8:58697529-58697551 GACCCACCCGGAGTCCCACCGGG + Intergenic
1042484639 8:69336789-69336811 TTCCCAGGCACAGTCCCACCTGG - Intergenic
1042635397 8:70868254-70868276 CCCCCACACAGAGTCCCAACTGG - Intergenic
1043085567 8:75827395-75827417 CCCCCACACAGAGTCCCCCCTGG + Intergenic
1044017141 8:87058403-87058425 TCCCCACACAGAGTCCCAACTGG - Intronic
1047760024 8:127947603-127947625 GAGTCAGGCAGAGTCTCACCCGG + Intergenic
1048046123 8:130775019-130775041 GCCCCACACAGAGTCCCTACTGG + Intergenic
1049047520 8:140164707-140164729 GGCCCATGCGGAGTTCCACCTGG - Intronic
1049656914 8:143803045-143803067 GACTCCTGCAGAGTCCCATCAGG - Intronic
1049658114 8:143807806-143807828 GAGCTGAGCAGAGTCCCACCGGG + Intronic
1050121582 9:2314034-2314056 CCCCCACACAGAGTCCCAACTGG + Intergenic
1050875063 9:10623647-10623669 GCCCCACGCAGAGTCCCCACTGG - Intergenic
1050915196 9:11122517-11122539 CCCTCACACAGAGTCCCACCTGG - Intergenic
1051582702 9:18694786-18694808 GCCCCACACAGAGTCTCAACTGG - Intronic
1052220619 9:26017492-26017514 GCCCCACACAGAGTCCCTACTGG - Intergenic
1052508412 9:29383340-29383362 GACCCACCCAGAGTCCCACAGGG + Intergenic
1053616367 9:39770446-39770468 GCCCCACACAGAGTCCCCACTGG - Intergenic
1053874532 9:42529753-42529775 GCCCCACACAGAGTCCCCACTGG - Intergenic
1053898082 9:42764834-42764856 GCCCCACGCAGAGTCCCCACTGG + Intergenic
1054237150 9:62571943-62571965 GCCCCACACAGAGTCCCCACTGG + Intergenic
1054267802 9:62937002-62937024 GCCCCACACAGAGTCCCCACTGG + Intergenic
1055595640 9:77862249-77862271 CCCCCACACAGAGTCCCTCCTGG - Intronic
1056792377 9:89634109-89634131 GTCCCACGCAGAGTCTCAGAGGG + Intergenic
1057564295 9:96154303-96154325 GAGTCAGGAAGAGTCCCACCGGG - Intergenic
1057930565 9:99189548-99189570 GACCCACCCACAGTCCCTACTGG + Intergenic
1059482278 9:114600744-114600766 GCCCCACACAGAGTCCCTACTGG - Intergenic
1060348771 9:122839177-122839199 GCCCCACACAGAGTCCCCACTGG - Intergenic
1060597373 9:124856519-124856541 GACCCCAGCAGTCTCCCACCAGG + Exonic
1061285807 9:129621829-129621851 GCCCCACCCAGAAGCCCACCAGG - Intronic
1061799013 9:133104127-133104149 GACCCTAGCAGAGCCACACCTGG - Intronic
1062341175 9:136094653-136094675 GACCCACGAACGGGCCCACCTGG + Intronic
1185910302 X:3974846-3974868 GACCCACCCAGAGTCCCACCGGG + Intergenic
1186797627 X:13062175-13062197 CCCCCACACAGAGTCCCTCCTGG - Intergenic
1188259684 X:28008101-28008123 TCCCCACGCAGAGTCCCCACTGG - Intergenic
1189087979 X:38047183-38047205 GCCCCACACAGAGTCCCTACTGG - Intronic
1190270614 X:48860457-48860479 GACCCACCCAGAGTCCCACCGGG + Intergenic
1190425496 X:50331303-50331325 GATCCACCTGGAGTCCCACCGGG - Intronic
1190771572 X:53519119-53519141 GACCCACCCGGAGTCCCACTGGG + Intergenic
1191052271 X:56206786-56206808 GCCCCACACAGAGTCCCATCTGG - Intergenic
1191607853 X:63081404-63081426 GCCCCACACAGAGTCCCCACTGG + Intergenic
1191639553 X:63415392-63415414 GACCCACCCAGAGTCCCACCAGG + Intergenic
1191917629 X:66219869-66219891 AACCCACCCAGAGTCCCACCGGG - Intronic
1191986637 X:66988150-66988172 GCCCCACACAGAGTCCCCACTGG - Intergenic
1192008561 X:67242851-67242873 GCCCCACACAGAGTCCCCACTGG + Intergenic
1192707087 X:73537850-73537872 GACCCACTCAGGGACCCAGCAGG + Intergenic
1192915149 X:75643986-75644008 GACCCACCTGAAGTCCCACCAGG - Intergenic
1193519568 X:82512216-82512238 GCCCCACACAGAGTCCCTACTGG - Intergenic
1193717668 X:84951143-84951165 GACCCACCCAGAGTCCCACCAGG + Intergenic
1193738244 X:85185972-85185994 GGCCCACGGCGAGTACCACCTGG + Intergenic
1194042761 X:88962461-88962483 GTCCCACACAGAGTCCCTACTGG + Intergenic
1194082886 X:89490041-89490063 GCCCCACACAGAGTCCCCACTGG - Intergenic
1194199881 X:90941487-90941509 GTCCCACACAGAGTCCCATCTGG - Intergenic
1194497489 X:94635520-94635542 TCCCCACACAGAGTCCCAACTGG + Intergenic
1194566444 X:95494555-95494577 GCCCCACACAGAGTCCCTACTGG + Intergenic
1196422679 X:115539055-115539077 GACCCACCCGGAGTCCCACCGGG - Intergenic
1196459732 X:115917754-115917776 AACCCACCCAGAGTCCCACTGGG - Intergenic
1197975694 X:132163581-132163603 CCCCCACACAGAGTCCCTCCTGG + Intergenic
1198667896 X:139044940-139044962 GCCCCACACAGAGTCCCCACTGG - Intronic
1198707246 X:139462469-139462491 CCCCCACACAGAGTCCCAACTGG + Intergenic
1199362865 X:146943277-146943299 CACCCACACAGAGTCCCTACGGG - Intergenic
1199776090 X:151013222-151013244 CACCCACACAGAGTCCCCACTGG - Intergenic
1200296484 X:154925348-154925370 CACCCACACAGAGTCCCTACTGG + Intronic
1200393745 X:155970266-155970288 GACTCACCTGGAGTCCCACCGGG - Intergenic
1200435537 Y:3145913-3145935 GCCCCACACAGAGTCCCCACTGG - Intergenic
1200545872 Y:4517903-4517925 GTCCCACACAGAGTCCCATCTGG - Intergenic
1200912543 Y:8543908-8543930 GACCCACCCAAAGTCTCACTGGG + Intergenic
1200943686 Y:8810376-8810398 GACCCACCCAGAGTCCCACAGGG + Intergenic
1200983309 Y:9281745-9281767 GACCCACACAGAGTCTCAATGGG - Intergenic
1201259817 Y:12148015-12148037 GACCCACCCAGAGTCCCACCAGG - Intergenic
1201270639 Y:12250634-12250656 GGCCCACCCAGAATCCCACCAGG + Intergenic
1201297141 Y:12473540-12473562 GACCCACCTGGAGTCCCACCGGG - Intergenic
1201373255 Y:13288386-13288408 GGCCCACCCAGAATTCCACCGGG + Intronic
1202127072 Y:21577952-21577974 GACCCACACAGAGTCTCAGTGGG + Intergenic
1202152181 Y:21853567-21853589 GACCCACACAGAGTCTCATCAGG - Intergenic