ID: 1020046755

View in Genome Browser
Species Human (GRCh38)
Location 7:5046198-5046220
Sequence GACCCAGATCCGCCTCCCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020046755_1020046760 -2 Left 1020046755 7:5046198-5046220 CCCGAGGGAGGCGGATCTGGGTC 0: 1
1: 0
2: 5
3: 15
4: 138
Right 1020046760 7:5046219-5046241 TCCCGGGAAGGACACCCGCCTGG 0: 1
1: 0
2: 3
3: 9
4: 96
1020046755_1020046768 22 Left 1020046755 7:5046198-5046220 CCCGAGGGAGGCGGATCTGGGTC 0: 1
1: 0
2: 5
3: 15
4: 138
Right 1020046768 7:5046243-5046265 TTTGCCCCTTAGGCCCGGCCCGG 0: 1
1: 6
2: 1
3: 9
4: 105
1020046755_1020046767 17 Left 1020046755 7:5046198-5046220 CCCGAGGGAGGCGGATCTGGGTC 0: 1
1: 0
2: 5
3: 15
4: 138
Right 1020046767 7:5046238-5046260 CTGGATTTGCCCCTTAGGCCCGG 0: 1
1: 6
2: 1
3: 13
4: 109
1020046755_1020046764 12 Left 1020046755 7:5046198-5046220 CCCGAGGGAGGCGGATCTGGGTC 0: 1
1: 0
2: 5
3: 15
4: 138
Right 1020046764 7:5046233-5046255 CCCGCCTGGATTTGCCCCTTAGG 0: 1
1: 4
2: 3
3: 7
4: 96
1020046755_1020046769 23 Left 1020046755 7:5046198-5046220 CCCGAGGGAGGCGGATCTGGGTC 0: 1
1: 0
2: 5
3: 15
4: 138
Right 1020046769 7:5046244-5046266 TTGCCCCTTAGGCCCGGCCCGGG 0: 1
1: 6
2: 1
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020046755 Original CRISPR GACCCAGATCCGCCTCCCTC GGG (reversed) Exonic
900156740 1:1206199-1206221 GGCACACCTCCGCCTCCCTCTGG + Intronic
900179609 1:1305472-1305494 CACCCAGAGCTGCCGCCCTCGGG + Intronic
902044435 1:13514119-13514141 GACCCAGGTCCCACTCCCTTTGG - Intergenic
902404415 1:16175019-16175041 GGCCCACAGCCCCCTCCCTCGGG - Intergenic
904005469 1:27361030-27361052 GACCAAGATGCCCCTCCCGCGGG - Intronic
904874401 1:33643155-33643177 GACCCAGCCCTGCCTCCCTGTGG + Intronic
905943598 1:41883795-41883817 GTCCCAGAGCCACCTCCATCTGG + Intronic
907796109 1:57719371-57719393 GACCTTGACCCACCTCCCTCTGG - Intronic
909490402 1:76219871-76219893 GATCCAGAACCGCTCCCCTCGGG - Intronic
918045065 1:180936492-180936514 GACCCAGCCCAGCCGCCCTCAGG + Exonic
922207939 1:223465338-223465360 GACTCAGCTCCACCTCCTTCAGG + Intergenic
923391118 1:233515239-233515261 GCCCCAGCTCCGCCCCCCGCCGG - Intergenic
1062802626 10:391350-391372 GACCCAGGTCTTCCTTCCTCTGG - Intronic
1062957941 10:1552441-1552463 CACACAGATCCTGCTCCCTCCGG - Intronic
1063577521 10:7275128-7275150 GCCCCAGGTCTGCCTCCCTGCGG - Intronic
1067682876 10:48451336-48451358 GCCGCAGAACCGCCTTCCTCAGG + Intronic
1068367505 10:56069165-56069187 GACCCAGGTCCAGCCCCCTCAGG + Intergenic
1073207519 10:101776532-101776554 GACCCAGACCCGCCAGACTCGGG - Intronic
1073425688 10:103454311-103454333 GACCCAGTTCTGTCTCACTCTGG + Exonic
1074025006 10:109625413-109625435 CATCCAGATCCCCCTCCTTCAGG + Intergenic
1075423983 10:122327552-122327574 GACCCTGGTCTGCCTGCCTCGGG + Intronic
1075426213 10:122343715-122343737 TCCCCAGATCCTCCTCCTTCTGG - Intergenic
1078064058 11:8066392-8066414 AACCCAGAGCCAGCTCCCTCTGG - Intronic
1079030125 11:16980470-16980492 GATCCACAGCCGCCTCCCACAGG + Intronic
1083631766 11:64099107-64099129 CAGCCAGACCTGCCTCCCTCTGG + Intronic
1083933415 11:65858054-65858076 GACCCGCAGCCGCCTCCCTCAGG + Intronic
1087181229 11:95144476-95144498 GACTCAGATCCGTCTCTCTGTGG + Intergenic
1089709969 11:120307576-120307598 GACCAACATCCGCCTGACTCTGG + Exonic
1091973778 12:4809568-4809590 GCGCCAGATGCGCCTCCCTCCGG - Exonic
1094827885 12:34286671-34286693 GACCCAGACCCCCTTCCCTATGG - Intergenic
1096182327 12:49557696-49557718 GACTCAGAGCCCCCTGCCTCAGG + Exonic
1097351704 12:58556193-58556215 GACCCATATCCTCATCCTTCAGG + Intronic
1099899117 12:88685022-88685044 GACCCATATCCTCATCCCTGAGG - Intergenic
1112448567 13:99489308-99489330 GAACCAAAGCCGCATCCCTCAGG - Intergenic
1114626821 14:24135908-24135930 GACCCGGACCCGCCGTCCTCAGG + Intergenic
1117326120 14:54670482-54670504 AACCCAGTTCTGCCTCCCCCAGG - Intronic
1117553212 14:56856995-56857017 AACCCAAATCTGCCTCCCTCTGG - Intergenic
1121100965 14:91249975-91249997 GACCCAGCTCCTCCTTCCCCAGG - Intronic
1121517406 14:94561725-94561747 GACCCAGAAAAGCCTCCCCCAGG + Intronic
1122082151 14:99273637-99273659 GCCTCAGCGCCGCCTCCCTCGGG + Intergenic
1122097815 14:99384239-99384261 GCCCCATCCCCGCCTCCCTCTGG - Intergenic
1122798907 14:104220207-104220229 GACCCTGATCCGCATCCATTAGG + Intergenic
1122992078 14:105241223-105241245 GACCCAGACCAGCATCCCCCAGG + Intronic
1123056269 14:105572140-105572162 GGCCCTGACCCGCCTCCCCCTGG + Intergenic
1123057664 14:105579667-105579689 GGCCCTGACCCGCCTCCCCCTGG - Intergenic
1123080698 14:105692268-105692290 GGCCCTGACCCGCCTCCCCCTGG + Intergenic
1123081943 14:105699600-105699622 GGCCCTGACCCGCCTCCCCCTGG - Intergenic
1128714834 15:69900544-69900566 GACCCAGAGGCACATCCCTCTGG - Intergenic
1132150147 15:99453288-99453310 GACCCACAGCCCCCTCCCTGCGG + Intergenic
1133061214 16:3175517-3175539 GACCCAGATCCAGCTACCTCGGG + Intergenic
1139593181 16:67944244-67944266 GGCCCAGAGCCGGCTCCCTGAGG - Exonic
1142226582 16:88880649-88880671 GCCCCAGATGCGCCTCTCACCGG - Intronic
1142358571 16:89615623-89615645 GAACCAGCTGCTCCTCCCTCAGG - Intronic
1142626710 17:1196990-1197012 GGCCAAGATCCGCCTTCCTAAGG + Intronic
1143106098 17:4531322-4531344 GACACAGCCCCGCCGCCCTCGGG + Intronic
1144822978 17:18088364-18088386 ACCCCAGCTCCGCCTCTCTCTGG - Intronic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1160690141 19:457930-457952 GACCCACTTCCGCCTCCCCCGGG - Intronic
1160716035 19:577235-577257 TTCCCAAATCCGCCTCTCTCTGG + Intronic
1160866434 19:1258255-1258277 GTCCCAAATCCACATCCCTCAGG - Exonic
1162568759 19:11458576-11458598 GACCCAGTTCAGCATCCATCCGG - Exonic
1162687602 19:12400680-12400702 ACCCCAGATCCGCCTCCCTGAGG - Intronic
1162691915 19:12440524-12440546 ACCCCAGATCCGCCTCCCTGAGG - Intronic
1165416828 19:35699600-35699622 GACCCAGATCTGCCTGACCCAGG - Intergenic
1165956562 19:39505019-39505041 TCCCCAGAGCCTCCTCCCTCTGG + Intronic
1166363881 19:42269055-42269077 GTCCAAGACCGGCCTCCCTCCGG - Intronic
1166727857 19:45039491-45039513 CAGCCAGCTCCGCCTCTCTCAGG + Intronic
1166821741 19:45584629-45584651 GACCTATATCTGCCTCCCGCCGG - Exonic
1168238173 19:55076300-55076322 GCCCCAGCCCCTCCTCCCTCAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
926867378 2:17374796-17374818 AACCAAGATCCACCTCCTTCAGG + Intergenic
926968371 2:18441099-18441121 GACCCAGAGCCACATTCCTCTGG + Intergenic
927151549 2:20199101-20199123 GACCCAGTTCAGCCACCCTCTGG + Intergenic
932139704 2:69264465-69264487 GACCCAGATCCTCATCCCTGTGG - Intergenic
932239766 2:70147423-70147445 GACCCATTTCTGCCTCTCTCTGG - Intergenic
934526638 2:95056210-95056232 GACTGAGGGCCGCCTCCCTCTGG + Intergenic
938603164 2:132864074-132864096 GACCCAGAACAGCCTCCCCAAGG + Intronic
942961016 2:181829823-181829845 GACCCAGACCCTTCTCCCTGAGG + Intergenic
943820563 2:192315318-192315340 GACCCAGCTACGCCTCCTACTGG + Intergenic
946172592 2:217904360-217904382 GGCCCAGGTCCTCCTCCCCCGGG + Intronic
946588983 2:221222017-221222039 TACACATATCCTCCTCCCTCAGG + Intergenic
948942243 2:241202370-241202392 GCCCCACACCCGCCTCCCTGGGG - Intronic
949076928 2:242065698-242065720 GGACCACATCCGCTTCCCTCGGG - Intergenic
1171412145 20:24954362-24954384 AACCCAGAGCCCCCTCCCTGGGG + Intronic
1172391161 20:34566416-34566438 GCTCCAGGGCCGCCTCCCTCTGG + Intronic
1174112814 20:48207918-48207940 GACCCAGATCAGTCTCCCTAAGG - Intergenic
1174347849 20:49944311-49944333 GGCCCACCTCAGCCTCCCTCAGG + Intronic
1175934082 20:62507064-62507086 GACCTGGATCCGCCTCCCCTTGG - Intergenic
1177608099 21:23408204-23408226 TACCCACATCCACTTCCCTCTGG - Intergenic
1178286870 21:31333187-31333209 TACCCAGATCCTCAGCCCTCGGG - Intronic
1178699089 21:34818460-34818482 GTCCCAGACCCCCCTCCTTCTGG + Intronic
1180691063 22:17716219-17716241 GACCCTGATCCGGCTCCAGCAGG - Intronic
1181180919 22:21067806-21067828 CACCCACATCCACCTCCCCCTGG + Intergenic
1183103524 22:35598563-35598585 GGCCCTGATCCGCCTGCCTGGGG - Intergenic
1183160607 22:36110554-36110576 GACCCCAATCTGCCTCCCGCTGG - Intergenic
1183939836 22:41287560-41287582 GCTCCAGATCCTCCTGCCTCAGG - Intergenic
1184100199 22:42338035-42338057 GGCCCAGTACCCCCTCCCTCTGG - Intronic
1184492996 22:44820810-44820832 CACACAGCTCGGCCTCCCTCGGG + Intronic
1184992534 22:48180479-48180501 CTCCCAGACCCTCCTCCCTCGGG + Intergenic
1185256194 22:49833654-49833676 GAACCAAATCCACCTCCCTCAGG - Intergenic
950184466 3:10936709-10936731 GCCCCAGGTCAGCTTCCCTCTGG - Intronic
950554366 3:13686249-13686271 GACCCAGACCCGCCCTCCCCTGG - Intergenic
953443082 3:42936487-42936509 TAGCCACACCCGCCTCCCTCGGG - Intronic
959475262 3:106803304-106803326 AACCCAGATCTGCCACCCACTGG + Intergenic
964556109 3:157940503-157940525 GAATCAGATCCGCCACCCCCTGG - Intergenic
967296273 3:187968174-187968196 AACCCAGATCCCCTTGCCTCCGG + Intergenic
968756653 4:2419480-2419502 GACCCAGATCCGCCGTGATCTGG - Intronic
969063883 4:4461817-4461839 CTCCCAGAGCCTCCTCCCTCTGG + Intronic
971159168 4:24115776-24115798 GACCCAGCTCAGCCTCCCTTTGG + Intergenic
978617624 4:110612197-110612219 GTCCCGGATCCTCCTTCCTCTGG - Intergenic
985929714 5:3047366-3047388 GTCCCAGATCTGCCTTCCACTGG - Intergenic
991099573 5:62777733-62777755 GATCCTGATCCACCTCCCCCAGG + Intergenic
992927044 5:81598881-81598903 AACCCAGATATGCTTCCCTCTGG + Intronic
993868254 5:93219933-93219955 GGCCCAGATTCTCATCCCTCAGG - Intergenic
995051957 5:107716990-107717012 TACCCAGCTCCAGCTCCCTCTGG + Intergenic
996900286 5:128537026-128537048 GACCCAGGCCCGCCTGCCGCCGG + Intronic
1002299964 5:178252445-178252467 GACCCTGTTCCACTTCCCTCCGG - Intronic
1002566763 5:180116507-180116529 GCCCAAGACCCGCCTCTCTCTGG + Intronic
1002828095 6:791969-791991 GACCCAGAAGAGCCACCCTCTGG - Intergenic
1004516544 6:16326642-16326664 GGCCCAGATCCACCTGCCTGTGG - Exonic
1004562074 6:16760840-16760862 GAGCCATGTCCTCCTCCCTCCGG - Intronic
1005133730 6:22542435-22542457 AACCCAGTTCCGTCTCCTTCAGG - Intergenic
1005216666 6:23536354-23536376 GAACCAGACACGCTTCCCTCAGG + Intergenic
1006052756 6:31356588-31356610 GTCCGAGATCCGCCTCCCTGAGG - Intronic
1008379615 6:50826361-50826383 GACCCAGATGCACCACACTCAGG + Intronic
1019136972 6:169915295-169915317 GACCCAGATCCCTGTTCCTCTGG + Intergenic
1020046755 7:5046198-5046220 GACCCAGATCCGCCTCCCTCGGG - Exonic
1020288766 7:6706609-6706631 AGCCCAGATCCGTCTCCCTGGGG + Exonic
1022350931 7:29565762-29565784 GACCCAGGGCGGCCTCCCTTTGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1026727305 7:72879686-72879708 GGCCCAGATCCGCCTCCCTGGGG - Exonic
1027116551 7:75486041-75486063 GGCCCAGATCCGCCTCCCTGGGG + Exonic
1027121845 7:75527743-75527765 GGCCCAGATCCGCCTCCCTGGGG + Intergenic
1027193290 7:76010560-76010582 GACCCAGCTCAGCCTCACCCTGG - Intronic
1027275276 7:76549662-76549684 GGCCCAGATCCGCCTCCCTGGGG - Intergenic
1029720987 7:102364212-102364234 GGCCCAGATCCGCCTCCCTGGGG - Exonic
1030829388 7:114202084-114202106 CATCCAGATCCTCTTCCCTCTGG - Intronic
1032002546 7:128274812-128274834 GACCCAGATCCCTGACCCTCAGG - Intergenic
1034962784 7:155372910-155372932 CGCCCACATCCGCCTCCCCCAGG + Intergenic
1035205703 7:157292768-157292790 GACCCAGTTCCGCCTGCCCCCGG - Intergenic
1035535474 8:387584-387606 GGACCACATCCGCTTCCCTCGGG - Intergenic
1035870612 8:3133158-3133180 GCCCCAGGTCGGCCTCCCCCAGG - Intronic
1036750474 8:11440542-11440564 GACCCAGCACTGCCTGCCTCTGG + Intronic
1039038606 8:33385522-33385544 GACCCAGACCCTCTTCCCTTAGG - Intronic
1043372921 8:79613277-79613299 GGCCCAGAGCCGCCTACCGCTGG + Intronic
1043988606 8:86724036-86724058 GACCCTCAGCCTCCTCCCTCCGG - Intronic
1045345621 8:101291032-101291054 GACCCAGATGGGTCACCCTCTGG + Intergenic
1049068350 8:140337590-140337612 CATCCAGATGCGCCTCCCTCCGG + Intronic
1055021977 9:71679863-71679885 GACCCAGGCGCTCCTCCCTCAGG + Intergenic
1056938182 9:90933648-90933670 CACCCACATCCGCCTCCTGCTGG - Intergenic
1057938123 9:99257727-99257749 GACCCAGATCCCCCAGCTTCAGG - Intergenic
1058730435 9:107844926-107844948 TACCCAGATGCCCTTCCCTCAGG - Intergenic
1059382375 9:113936194-113936216 GACCCAGGTCTGTCTGCCTCTGG - Intronic
1060479148 9:124007895-124007917 GCCCCAGACCCGCCTGCCTGGGG - Intronic
1062014980 9:134286860-134286882 GCCCCAGCTCTGCCACCCTCTGG + Intergenic
1062087287 9:134655312-134655334 GCTCCACCTCCGCCTCCCTCGGG - Intronic
1186879192 X:13847996-13848018 CACCCAGATTCCCCTCCTTCCGG + Intronic
1190244682 X:48683544-48683566 GGCTCAGACCCTCCTCCCTCTGG - Intronic