ID: 1020049290

View in Genome Browser
Species Human (GRCh38)
Location 7:5071481-5071503
Sequence CTGTGGTTCCAGTACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1454
Summary {0: 2, 1: 6, 2: 52, 3: 290, 4: 1104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020049283_1020049290 29 Left 1020049283 7:5071429-5071451 CCGTCTCTACAAAAGATAATTTT 0: 4
1: 37
2: 379
3: 1445
4: 5134
Right 1020049290 7:5071481-5071503 CTGTGGTTCCAGTACTCAGGAGG 0: 2
1: 6
2: 52
3: 290
4: 1104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020049290 Original CRISPR CTGTGGTTCCAGTACTCAGG AGG Intronic
900201537 1:1409563-1409585 TTGTGGTTCAGCTACTCAGGAGG - Intergenic
900223310 1:1520880-1520902 CTGTGGTCCCACTACTCAAGAGG + Intronic
900494848 1:2971770-2971792 CTGGGGCTCCAGTGCTCGGGAGG - Intergenic
900660883 1:3782836-3782858 CTGTGGTCCCAGCACTCAGGAGG + Intronic
901247215 1:7741438-7741460 CTGTAGTCCCAGTACTCGGGAGG + Intronic
901261175 1:7872176-7872198 CTATAGTCCCAGTACTCGGGAGG + Intergenic
901300597 1:8197605-8197627 CTGTGGTCCCATGACTCGGGAGG + Intergenic
901874050 1:12156092-12156114 CTGTAGTTCAGCTACTCAGGAGG + Intergenic
902046233 1:13526783-13526805 CTGTAGCCCCACTACTCAGGAGG + Intergenic
902049889 1:13554927-13554949 CTGGCGTTCCTGTCCTCAGGCGG - Intergenic
902118975 1:14145320-14145342 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
902140283 1:14348005-14348027 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
902922410 1:19674526-19674548 CTGTAGTCCCACTACTCAGGAGG - Intronic
903133822 1:21296389-21296411 CTGTGGCCCCACTACTTAGGAGG + Intronic
903204464 1:21770601-21770623 CTGTAGTCCCACTACTCAGAAGG - Intronic
903439682 1:23378239-23378261 CTGGGGTTCTAGTACTTGGGAGG + Intergenic
903532931 1:24045785-24045807 CTGTAGTTCTAGTAATCAGGAGG - Intergenic
903595701 1:24492582-24492604 CTGTGGTCCCAGCTCTTAGGAGG - Intergenic
903855327 1:26334300-26334322 CTATGGTCCCAGGTCTCAGGAGG + Intronic
903916725 1:26770089-26770111 CTGTGGTCCCACTACTTGGGAGG + Intronic
904182040 1:28672859-28672881 CTGTAGTCCCAGTACTCGGGAGG - Intronic
904761553 1:32808339-32808361 CTGTAATCCCAGTACTCAGGAGG - Intronic
905139913 1:35835130-35835152 CTGTAGTCCCAGTACTTGGGGGG - Intronic
905139925 1:35835177-35835199 CTGTAGTCCCAGTACTTGGGGGG - Intronic
905375451 1:37517115-37517137 CTGTAATCCCTGTACTCAGGAGG + Intergenic
905497740 1:38407272-38407294 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
905729112 1:40283381-40283403 CTGTAATCCCAGTACTCAGGAGG + Intronic
905739771 1:40360423-40360445 CTGTAATCCCACTACTCAGGAGG - Intronic
905771137 1:40638724-40638746 CTTTGGGTCCAGGACACAGGTGG - Intronic
906021774 1:42635684-42635706 CTGTAGTCCCGCTACTCAGGAGG + Intronic
906035001 1:42745086-42745108 CTGTGGTCCCAATACTAAGGAGG - Intergenic
906230555 1:44159269-44159291 CTGTAGTCCCAGTTATCAGGAGG - Intergenic
906992508 1:50754375-50754397 CTTTGGTTACACTACTCAGAAGG - Intronic
907001724 1:50866262-50866284 ATCTTGTTCCAGTTCTCAGGGGG - Intronic
907031883 1:51180508-51180530 CTCTAGTCCCAGTACTCAGGAGG - Intergenic
907041960 1:51269307-51269329 CTGTGGCCCCACTACTCAGGAGG + Intronic
907119685 1:51997488-51997510 CTGGGGTGCCAGTCCTCAGCTGG - Intergenic
907251831 1:53144611-53144633 TTGTGTTTCTAGTACCCAGGGGG - Intergenic
907343149 1:53751829-53751851 CTGTGGTTCCAGGAGCCATGTGG + Intergenic
908743533 1:67353445-67353467 CTGTGGTTCCACTACTTGGGAGG + Intronic
908747308 1:67388053-67388075 CTGTAGTCCCGGTATTCAGGAGG + Intronic
908750067 1:67413525-67413547 CTGTGATCCCACTACTCAAGAGG + Intronic
908750848 1:67421829-67421851 CTGTAGTCCCAGTACTCGGGAGG + Intronic
908759779 1:67500885-67500907 CTGGGTTTCAATTACTCAGGAGG + Intergenic
908883733 1:68763145-68763167 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
909658170 1:78053806-78053828 CTGTAGTCCCAGTATTCAGGAGG + Intronic
909702143 1:78537743-78537765 CTGTGCTACCAGTACTAAGAGGG + Exonic
910195731 1:84637849-84637871 CTGTAGTCCCAGTACTAGGGAGG + Intergenic
910278306 1:85471230-85471252 CTATGGTTCCAGCTCTCAGCTGG + Intronic
910487214 1:87728631-87728653 CAGAGGTTACAGTACACAGGCGG - Intergenic
910867394 1:91800959-91800981 CTGTAATCCTAGTACTCAGGAGG + Intronic
910979630 1:92946684-92946706 CTGTAGTCCCAGTACTTTGGGGG + Intronic
911116712 1:94253224-94253246 CTGTAATTCCAGCACTTAGGGGG - Intronic
911265572 1:95739177-95739199 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
911303911 1:96209573-96209595 CTGTGCTTCCAACACTCTGGAGG + Intergenic
911388224 1:97204671-97204693 CTGTGATTCCCTTACTCAGAGGG + Intronic
911614124 1:99989885-99989907 CTGTGGTCCCAGCATTCAAGAGG - Intronic
911743584 1:101414626-101414648 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
911805868 1:102207394-102207416 ATTTTGTTCCAGTTCTCAGGGGG + Intergenic
911910992 1:103634946-103634968 CTGTAGTCCCACTACTCAGGAGG + Intergenic
911918407 1:103729071-103729093 CTGTAGTCCCACTACTCAGGAGG + Intronic
912314779 1:108657916-108657938 CTGTGGTCCAAGTAGGCAGGAGG + Intronic
912482235 1:109992058-109992080 TTGTGGTTCCAGAAATCTGGGGG + Intronic
912653226 1:111460040-111460062 CTGTAGTTCAGCTACTCAGGAGG + Intronic
912767959 1:112433468-112433490 CTGTAATCCCACTACTCAGGAGG + Intronic
912920282 1:113860104-113860126 CTGTGGTCCCAGCTTTCAGGAGG - Intronic
913002112 1:114591086-114591108 CTGTAGTCTCACTACTCAGGAGG - Intronic
913003280 1:114603260-114603282 CTGTAGTCCCACTACTCGGGAGG - Intronic
913103058 1:115587337-115587359 CTGTCCTCCCAGTGCTCAGGTGG - Intergenic
913121247 1:115742908-115742930 CTGTAGTCCCACTACTCGGGAGG - Intronic
913338061 1:117728518-117728540 GTTTTGTTCCAGTACTCAGGGGG - Intergenic
913402593 1:118453064-118453086 GTCTTGTTCCAGTTCTCAGGTGG - Intergenic
915084122 1:153373346-153373368 CTGTAGTTCCAGTACTCAGGAGG - Intergenic
915872490 1:159575734-159575756 CTGTAGTCCCAGCACTCGGGAGG + Intergenic
915966307 1:160311623-160311645 CTGTAGTCCCAGTACTTGGGAGG + Intronic
916030951 1:160877113-160877135 CTGTAGTCCCACTACTCAGGAGG + Intronic
916331345 1:163620926-163620948 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
916347565 1:163811207-163811229 CTGTAATTCCAGCACTCTGGGGG + Intergenic
916758800 1:167798438-167798460 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
917018213 1:170558540-170558562 ATGTGATTGCAGTAGTCAGGTGG + Intergenic
917110073 1:171538831-171538853 CTGTAGTCCAACTACTCAGGAGG - Intronic
917119310 1:171631830-171631852 CTGTAGTCCCAGTACTTTGGGGG - Intergenic
917317243 1:173738562-173738584 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
917348466 1:174053299-174053321 CTGTAGTTCGGCTACTCAGGAGG + Intergenic
917404300 1:174686776-174686798 CTGTAGTCCCACTACTCTGGAGG - Intronic
917425076 1:174904769-174904791 CTGTAGTCCCAATACTCAGGAGG - Intronic
917636713 1:176944197-176944219 CTGTAATCCCAGCACTCAGGAGG - Intronic
917715092 1:177726923-177726945 CTGCAGTCCCAGCACTCAGGAGG + Intergenic
917909702 1:179630914-179630936 CTGTGGTTCCACTCACCAGGTGG - Exonic
918731380 1:188001440-188001462 CTGTAGTCCCAGTACTCTGGAGG - Intergenic
918819448 1:189233490-189233512 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
919331832 1:196181836-196181858 TTGGGGTTCCAGTACTAAAGAGG - Intergenic
919407707 1:197205316-197205338 ATTTTGTTCCAGTTCTCAGGGGG + Intergenic
920082264 1:203383400-203383422 CTGTAATTCCAGCACTTAGGAGG - Intergenic
920129379 1:203719948-203719970 CTGTAGTCCCGTTACTCAGGAGG + Intronic
920217683 1:204373028-204373050 CTGTAGTCCTAGCACTCAGGGGG - Intronic
920272781 1:204778841-204778863 CTGTAATTCCAGTACTCAAGAGG + Intergenic
920323335 1:205141522-205141544 CTGTGGTCCAGATACTCAGGAGG + Intergenic
920393011 1:205622513-205622535 CTGTAGTCCCAGTGCCCAGGAGG - Intronic
920745671 1:208625702-208625724 CTGCAATCCCAGTACTCAGGAGG + Intergenic
920768933 1:208861700-208861722 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
920919817 1:210289277-210289299 CTGTAATCCCAGTACTCAGGAGG - Intergenic
920954529 1:210605976-210605998 CTGTAGTCCCGCTACTCAGGAGG - Intronic
921226263 1:213022933-213022955 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
921497044 1:215854409-215854431 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
921619386 1:217309351-217309373 CTGTAGTCCCAGCACTTAGGAGG + Intergenic
921729007 1:218555773-218555795 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
921803561 1:219429533-219429555 CTGTGGTTCCACCACTTGGGGGG + Intergenic
921928771 1:220736045-220736067 CTGTAGTACCGCTACTCAGGAGG + Intergenic
922691848 1:227699176-227699198 CTGTAGTCCCAGTACTTTGGGGG - Intergenic
922766970 1:228161108-228161130 CTGTGGTCCCAGTACTCAGGAGG + Intergenic
922798961 1:228355425-228355447 CTGTGGTTCCAGTGATCGGATGG - Intronic
922810034 1:228410215-228410237 CTGTGGTCCCAGGACTCAGGAGG - Intronic
923128233 1:231051257-231051279 CTGTAATCCCAGTACTCAGGAGG + Intergenic
923174485 1:231450682-231450704 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
923407981 1:233681513-233681535 CTGTGCTTCCACTACTTGGGAGG - Intergenic
923493958 1:234508704-234508726 CTGTAGTCCCAGTACTCGGGAGG - Intergenic
923803955 1:237238074-237238096 CTGTGGTCCTGCTACTCAGGAGG - Intronic
923955083 1:239007940-239007962 CTGTAGTCCCACTACTCGGGAGG + Intergenic
924878901 1:248136814-248136836 AGGTGGCTCCAGTCCTCAGGGGG + Intergenic
924881128 1:248164329-248164351 AGGCGGCTCCAGTACTCAGGGGG + Intergenic
924881306 1:248164946-248164968 GGGTGGCTCCAGTCCTCAGGGGG + Intergenic
924885073 1:248206368-248206390 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
924893113 1:248306434-248306456 AGGGGGTTCCAGTCCTCAGGCGG - Intergenic
924893152 1:248306573-248306595 AGGGGGTTCCAGTCCTCAGGCGG - Intergenic
924893191 1:248306710-248306732 AGGGGGTTCCAGTCCTCAGGCGG - Intergenic
924893215 1:248306795-248306817 AGGGGGTTCCAGTCCTCAGGCGG - Intergenic
924893235 1:248306863-248306885 AGGGGGTTCCAGTCCTCAGGCGG - Intergenic
924893249 1:248306914-248306936 CGGCGGCTCCAGTCCTCAGGCGG - Intergenic
924945667 1:248845138-248845160 CTATAATCCCAGTACTCAGGAGG + Intronic
1063502457 10:6567521-6567543 CTGTGCTTACATTCCTCAGGAGG + Intronic
1063689370 10:8271801-8271823 CTGTAGTTCCAGCTATCAGGAGG + Intergenic
1064050065 10:12052344-12052366 CTGTAGTCCCACTACTCGGGAGG + Intergenic
1064262155 10:13794553-13794575 CTGAGTTTGAAGTACTCAGGTGG + Intronic
1064556888 10:16555817-16555839 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1064623041 10:17234235-17234257 CTGTGGTTCCAGCTCTTAGGGGG - Intronic
1064823743 10:19371138-19371160 CTGTCGTCCCAGCTCTCAGGAGG + Intronic
1065032228 10:21599054-21599076 CTGTAATCCCACTACTCAGGAGG + Intronic
1065137507 10:22686590-22686612 CTGTGGTCTCAGTACTCAGGAGG - Intronic
1065353385 10:24815621-24815643 CTGTAGTTCCAGTACTCGGGAGG + Intergenic
1065418242 10:25512599-25512621 CTTGTGTTCCAGTTCTCAGGGGG + Intronic
1065572134 10:27081857-27081879 CTATAGTCCCAGTACTCAGGAGG - Intronic
1065601008 10:27368731-27368753 CTGTAATTCCACTACTCAGTAGG - Intergenic
1065960367 10:30729298-30729320 CTGTGGTCCCAGAACTTGGGAGG - Intergenic
1066084852 10:31966150-31966172 CTGTAGTCCCACGACTCAGGAGG + Intergenic
1066214957 10:33277328-33277350 CTTTGTTTCCAGTAGTCATGAGG - Intronic
1066245312 10:33577500-33577522 CTGTAGTCCTAGCACTCAGGAGG + Intergenic
1066260738 10:33727483-33727505 CTGTAGTTGCTCTACTCAGGAGG - Intergenic
1066311568 10:34202193-34202215 CTGTAATTCCACTACACAGGAGG - Intronic
1066372106 10:34825908-34825930 CTATAGTCCCAGTACTCAGGAGG + Intergenic
1066420020 10:35256474-35256496 CTGTAATTCCAGCACTCTGGGGG + Intronic
1066706484 10:38184845-38184867 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1066973363 10:42339386-42339408 CTGTGGTACCAGTAAACAGGAGG + Intergenic
1066980190 10:42405859-42405881 CTGTAATCCCAGTAGTCAGGAGG - Intergenic
1067254369 10:44621363-44621385 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1067323933 10:45248479-45248501 CTGTAGTCCCAGTACTTAGGAGG - Intergenic
1067533808 10:47093407-47093429 CTGTGGTTCCAGCAATCTTGGGG + Intergenic
1068172768 10:53417472-53417494 GTATTGTTCCAGTTCTCAGGGGG + Intergenic
1068629020 10:59280550-59280572 GTGTGGTTCTATTATTCAGGAGG + Intronic
1069142059 10:64839306-64839328 CTGTAGTCCCAGTACTTGGGAGG + Intergenic
1069282796 10:66676619-66676641 CTATGGTCCTAGGACTCAGGAGG + Intronic
1069368922 10:67723411-67723433 CTGTAGTTCCACTACTTGGGAGG - Intergenic
1069388150 10:67903504-67903526 CTGTAGTCCCACTACTCGGGAGG - Intronic
1069528846 10:69199964-69199986 CTGTTGCTCTAGTACTCGGGGGG - Intronic
1069648543 10:70023941-70023963 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1069698691 10:70406101-70406123 CTGTGGTCCAGCTACTCAGGAGG - Intronic
1069923689 10:71833334-71833356 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1070094202 10:73320787-73320809 CTGTAGTTCCAGCTATCAGGAGG - Intronic
1070109083 10:73464807-73464829 CTGTAATCCCACTACTCAGGAGG + Intronic
1070291357 10:75117298-75117320 CTATAGTCCCAGAACTCAGGAGG + Intronic
1070957099 10:80471378-80471400 CTGTGCCTCCAGACCTCAGGAGG - Intronic
1071083806 10:81844306-81844328 CTGTAGTCCCGCTACTCAGGAGG + Intergenic
1071592363 10:86886950-86886972 CTGTAATCCCAGTATTCAGGTGG - Intronic
1071623416 10:87143983-87144005 CTGTAGTCCCACTACTCAGGAGG - Intronic
1071682862 10:87724974-87724996 CTGCGGTTCAAGTCCACAGGCGG + Intronic
1071800131 10:89050624-89050646 CTGTAATCCCAGTACTCGGGAGG - Intergenic
1072098956 10:92210912-92210934 CTGTAATCCCACTACTCAGGAGG + Intronic
1072349567 10:94544173-94544195 CTGTGGTCCTAGTACTTGGGAGG - Intronic
1072381451 10:94875931-94875953 GTATTGTTCCAGTTCTCAGGGGG + Intergenic
1072396681 10:95050147-95050169 CTGTGGTAGCACTGCTCAGGGGG + Intronic
1072596518 10:96877400-96877422 CTGTAGTCCCAGTACTTGGGAGG + Intronic
1072700266 10:97635676-97635698 CTGTGGTGCCAGCACTCGGGAGG + Intronic
1072844530 10:98815158-98815180 CTGTGGTCCCAGTACTCAGGAGG + Intronic
1072885657 10:99271058-99271080 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1073071987 10:100800398-100800420 CTGTGGCTCAGCTACTCAGGAGG - Intronic
1073219826 10:101861925-101861947 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1073304949 10:102495605-102495627 CTATAGTCCCAGTACTCGGGAGG + Intronic
1073371847 10:102996580-102996602 CTGTAGTCCTAGTACTCGGGAGG + Intronic
1073536227 10:104279193-104279215 CTGTGGTTCCGGTTCTCAGTAGG - Intronic
1073833627 10:107415516-107415538 CTGTCCTCCCAGTACACAGGTGG + Intergenic
1073849960 10:107603382-107603404 CTGTGGTCCCAGCACTCAAGAGG + Intergenic
1074096153 10:110314807-110314829 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1074142281 10:110684270-110684292 CTGTAGTCCCACTACTCAGGAGG + Intronic
1074170759 10:110933674-110933696 CTGTAGTCCCACTACTCTGGAGG + Intronic
1074613524 10:115043199-115043221 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1074770952 10:116733393-116733415 CAGTGGTTCCTGTACCCAGGCGG - Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1075141038 10:119835956-119835978 CTGTGGTCCCACTACTGAGGAGG - Intronic
1075338571 10:121627015-121627037 TTGTAGTTCTAGTACTCATGGGG + Intergenic
1075351716 10:121730392-121730414 CTGTAGTCCCGCTACTCAGGAGG - Intergenic
1075660283 10:124189651-124189673 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG + Intergenic
1077063947 11:630477-630499 CTGTAGTCCCACTACTTAGGAGG - Intergenic
1077268309 11:1663188-1663210 CTGTGGCTCCAGTGCCCCGGAGG + Intergenic
1077591207 11:3492357-3492379 CTGTAGTCCCAGTACTTGGGGGG - Intergenic
1077917596 11:6621607-6621629 CTGTGGTCCTAGTACTCTGAGGG + Exonic
1078247372 11:9587080-9587102 CTGTGGCTCAGCTACTCAGGAGG - Intronic
1078326193 11:10383172-10383194 CTGTAATTCCAGTACTTTGGGGG + Intronic
1078686976 11:13541797-13541819 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1078724357 11:13916196-13916218 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1078964705 11:16325070-16325092 CTGTTGTCCCAATACTCAGAGGG - Intronic
1078991510 11:16651696-16651718 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1079231677 11:18654543-18654565 CTGTAATCCCACTACTCAGGAGG + Intergenic
1079369720 11:19840372-19840394 CTTTGGTTTCATTATTCAGGTGG + Intronic
1079604319 11:22345431-22345453 CTGTAGTCCCACTACTCGGGAGG - Intronic
1079805721 11:24928304-24928326 GTTTTGTTCCAGTTCTCAGGAGG + Intronic
1079921878 11:26442886-26442908 CTGTAATCCCAGTACTCAGGAGG - Intronic
1080205956 11:29729427-29729449 CTTTTGTTCCAGTTCTCAAGGGG - Intergenic
1080380821 11:31770779-31770801 CTGTAGTCTCAGTACTCGGGAGG + Intronic
1080467742 11:32513836-32513858 CTGTAATTCCACTACTCAGGAGG + Intergenic
1080468225 11:32518608-32518630 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
1080670117 11:34368359-34368381 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1080732171 11:34968147-34968169 CTGTAGTCCAACTACTCAGGCGG + Intronic
1081259101 11:40936457-40936479 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1081481847 11:43496881-43496903 CTGTAGTCCCACTACTCGGGAGG - Intergenic
1081823650 11:46024676-46024698 CTATAATCCCAGTACTCAGGAGG + Intronic
1082104376 11:48204643-48204665 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1082694024 11:56337575-56337597 GTGTGGTTCCAATAATCAGAAGG + Intergenic
1082870221 11:57937430-57937452 CTGTAGTTTCAGTACTTTGGAGG - Intergenic
1083023175 11:59527677-59527699 CAGGGGTTCCAGTTCTGAGGAGG - Intergenic
1083342076 11:61964968-61964990 CTGGGGTTCCAATACTCACATGG + Exonic
1083567733 11:63734323-63734345 TTGTAATCCCAGTACTCAGGAGG + Intronic
1083574582 11:63780740-63780762 CTGTAGTCCCACTACTCGGGAGG + Intergenic
1083785218 11:64941277-64941299 CTGAGGTTTCAGAAATCAGGAGG + Intronic
1084126321 11:67101452-67101474 CTGTAGTCCCAGTACTCAGGAGG + Intergenic
1084311952 11:68322198-68322220 CTGTGTCTACAGTGCTCAGGAGG - Intronic
1085056908 11:73410147-73410169 CTGTAGTTCCAGCACTTTGGAGG + Intronic
1085108308 11:73865131-73865153 TTGTAGTCCCACTACTCAGGAGG + Intronic
1085187729 11:74590690-74590712 CTGTGGTCCCAGTTCTGAAGTGG - Intronic
1085245096 11:75094624-75094646 CTGTGGTCTCACTACTCAGAAGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085881220 11:80468520-80468542 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1086103458 11:83125817-83125839 CTGTGGTCCCAATACTCAGGAGG - Intergenic
1086416323 11:86592087-86592109 ATGTGGTCCCAGTTCTCAGGTGG - Intronic
1086513573 11:87587248-87587270 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1087004574 11:93456883-93456905 CTGTAATCCCACTACTCAGGAGG + Intergenic
1087278414 11:96183518-96183540 CTGTGGTCCCAGTTATCAGGAGG - Intronic
1087731340 11:101781571-101781593 GTCTTGTTCCAGTTCTCAGGCGG + Intronic
1087813621 11:102634512-102634534 CTGTAGTCCCACTACTCAGGAGG + Intergenic
1087819017 11:102690138-102690160 CTGCAGTCCCAGTACTCGGGGGG - Intergenic
1087865889 11:103226283-103226305 CTCTTGTTCCAGTTCTCATGGGG + Intronic
1087905057 11:103685992-103686014 ATATTGTTCCAGTTCTCAGGGGG - Intergenic
1088055364 11:105569670-105569692 CTTTACTTTCAGTACTCAGGAGG + Intergenic
1088114084 11:106296666-106296688 CTGTGATCCCAGTATTCTGGAGG - Intergenic
1088274122 11:108066219-108066241 CTGCTGTCCCAGTACTCAGGAGG + Intronic
1088346357 11:108830615-108830637 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1088832676 11:113550858-113550880 CTATAGTTCCAGTACTTGGGAGG - Intergenic
1089368892 11:117939498-117939520 CTGTAATTCCACTACTCGGGAGG + Intergenic
1089521336 11:119066306-119066328 CTGTAATTCCAGTACTTGGGAGG + Intergenic
1089984521 11:122800728-122800750 TTGTGGTCCCAGCACTCAGGAGG - Intronic
1090432224 11:126655571-126655593 AAGTGGTTCCAGTCCCCAGGGGG - Intronic
1090962505 11:131569697-131569719 CTGTAGTCCCAGCTCTCAGGTGG - Intronic
1090976124 11:131682347-131682369 CTGTGGTTGCAGGCCACAGGGGG + Intronic
1091722725 12:2824991-2825013 CTGTGGTTGCAGTCCTTTGGTGG + Exonic
1092030335 12:5278524-5278546 CTGTGATCCCAGTGCACAGGAGG - Intergenic
1092798566 12:12139599-12139621 CTGTAGTCCAGGTACTCAGGAGG + Intronic
1092898654 12:13037939-13037961 CTATAGTCCCAGCACTCAGGAGG + Intergenic
1093505588 12:19862113-19862135 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1093554419 12:20453507-20453529 CTGAGGTACCAGTATACAGGTGG + Intronic
1093597981 12:20984648-20984670 GTGTTGTTCCAGTTCTCAGAGGG + Intergenic
1093716459 12:22388554-22388576 CTGTAGTTCCAGTACTGAGGAGG + Intronic
1093961114 12:25273788-25273810 GTGTAGTCCCACTACTCAGGAGG - Intergenic
1093964078 12:25307126-25307148 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1094621754 12:32086696-32086718 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1095176629 12:39099837-39099859 CTTTTGTTCCAGTTCTCAGAAGG - Intergenic
1095264141 12:40133758-40133780 CTGTGGTTCTAGGAATCAGAAGG - Intergenic
1095448562 12:42305690-42305712 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1095572076 12:43694768-43694790 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1095581830 12:43808686-43808708 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1095687753 12:45054505-45054527 ATGTTGTTCCAGTTCTCAGAAGG - Intergenic
1095784823 12:46098478-46098500 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1096108523 12:49014004-49014026 CTGTAATTCCAGCTCTCAGGAGG - Intronic
1096307144 12:50487763-50487785 CTGTAATCCCAGTACTTAGGAGG + Intergenic
1096640578 12:52991151-52991173 CTGTTATCCCAGTACTCGGGAGG - Intergenic
1096813474 12:54186462-54186484 CTGTAATCCCAGTACCCAGGAGG - Intronic
1096863173 12:54544874-54544896 CTGTAGTCCCACTACTCAGGAGG + Exonic
1097017286 12:55996597-55996619 CTGTAGTCCCAGTACTCGGGAGG - Exonic
1097025331 12:56050990-56051012 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
1097056099 12:56250312-56250334 CTGTAATTCCAGCACTGAGGTGG - Intronic
1097115719 12:56695367-56695389 CTGTGATCCCAGTACTTAGGGGG + Intergenic
1097175621 12:57141264-57141286 CTGGGGTTTCAGATCTCAGGAGG - Intronic
1097603718 12:61726793-61726815 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1097607432 12:61772782-61772804 TTCTTGTTCCAGTTCTCAGGGGG - Intronic
1097651169 12:62298705-62298727 CTGTAGTCCCAGTACTTGGGAGG + Intronic
1098108318 12:67094484-67094506 CTGTAATTTCAGTACTCGGGAGG + Intergenic
1098830588 12:75357066-75357088 CTGTAGTTCAGTTACTCAGGAGG + Intronic
1098833824 12:75396284-75396306 CTGTAGTCCCAGTACTTAGGAGG - Intronic
1099031500 12:77530948-77530970 CTGTAGTCCCAGATCTCAGGAGG + Intergenic
1099247825 12:80215286-80215308 CTATAATCCCAGTACTCAGGAGG - Intronic
1099272726 12:80532342-80532364 CTGTGGTCCCAGCTTTCAGGAGG - Intronic
1099400377 12:82196055-82196077 CTCTTGTTCTAGTTCTCAGGGGG - Intergenic
1099739409 12:86612616-86612638 CTGTAGTACCAGCTCTCAGGAGG + Intronic
1100282141 12:93128164-93128186 CTCTGGCACCAGTACACAGGAGG + Intergenic
1100422037 12:94444274-94444296 CTGTAATCCCAGTACTCAGGAGG + Intronic
1100501218 12:95175676-95175698 CAGAGGTTGCAGTACTCAGGAGG + Intronic
1100835053 12:98558716-98558738 CTGTAGTCCCACTACTCAGGAGG - Intergenic
1100918855 12:99459331-99459353 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1101137198 12:101756450-101756472 CTGTGGTTCCACTAGTCAGGAGG + Intronic
1101166682 12:102043389-102043411 CTGTGGTCTCACTACTCGGGAGG - Intronic
1101166862 12:102046415-102046437 CTGTAGTCCCAGCACTCGGGAGG - Intronic
1101378170 12:104188978-104189000 CTGTGTTCCCAGTACCCAGTAGG + Intergenic
1101523375 12:105505405-105505427 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
1101689159 12:107059371-107059393 CACTAGTTTCAGTACTCAGGAGG - Intronic
1101813106 12:108124591-108124613 CTGTGGTCCCAGGACTCAGAAGG - Intergenic
1102049668 12:109853564-109853586 CTGTAGTCCCACTACTCGGGAGG + Intronic
1102104064 12:110305279-110305301 CTGTAGTCTCACTACTCAGGAGG + Intronic
1102138355 12:110594009-110594031 CTGTAGTTCCTGTACTCAGGAGG - Intergenic
1102184856 12:110940082-110940104 CTGTGGTCCCACTACTCCAGAGG - Intergenic
1102279511 12:111607942-111607964 CTGTAATCCCAGTACTCAGCAGG - Intergenic
1102338773 12:112105195-112105217 CTGCAGTCCCAGTACTCAGGAGG + Intronic
1103196594 12:119048800-119048822 CTATAGTCCGAGTACTCAGGAGG + Intronic
1103477049 12:121226419-121226441 CTGTAATCCCACTACTCAGGAGG + Intronic
1103649260 12:122420811-122420833 CTGTAATTCCAGTACTCAGGAGG + Intronic
1103687532 12:122743898-122743920 CTGTACTCCTAGTACTCAGGAGG - Intergenic
1103694434 12:122802768-122802790 CTGTAGTCCCAGTACTTGGGAGG + Intronic
1103912101 12:124357551-124357573 CTGTAATTCCAGCACTCTGGAGG - Intronic
1103958720 12:124594164-124594186 CTGTGGTCTCAGCTCTCAGGAGG - Intergenic
1104037709 12:125109371-125109393 CTGTAATTCCAGCACTCAGGAGG - Intronic
1104627851 12:130374599-130374621 CTGTGCTGCCAGAACTCAAGTGG + Intergenic
1105228978 13:18471111-18471133 CTGTGGTCCCAGTAAACAGGAGG + Intergenic
1105370555 13:19798255-19798277 CTGAAGTCCCAGTACTCAGGAGG + Intergenic
1105502565 13:20985614-20985636 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1105514536 13:21077707-21077729 CTGGGATCCCAGCACTCAGGAGG - Intergenic
1105598553 13:21863546-21863568 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1105671755 13:22626248-22626270 CTGTGGTTTTAGAAATCAGGTGG + Intergenic
1105990068 13:25611214-25611236 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1106011928 13:25832193-25832215 CTGTAATTCCAGCACTCTGGGGG - Intronic
1106017449 13:25883295-25883317 CTGTAATTCCAGTACTCAGGAGG + Intronic
1106043876 13:26119297-26119319 GTGTGGTGCCAGTCCTCAAGAGG + Intergenic
1106264284 13:28096230-28096252 CTGTAGTCCCACAACTCAGGAGG + Intronic
1106325661 13:28686196-28686218 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1106515461 13:30449458-30449480 CTGTAGTCCCACTACTCAAGAGG + Intergenic
1107443822 13:40452331-40452353 ATTTGGTTCCAGTATTCAGATGG + Intergenic
1107471135 13:40692275-40692297 CTGTGGTCCCGCTACTCAAGAGG + Intergenic
1107894556 13:44948262-44948284 CTGTAGTCCCAGTACCCAGGAGG - Intronic
1107936370 13:45348721-45348743 CTGTAATCCCAGGACTCAGGAGG - Intergenic
1108072366 13:46641382-46641404 CTGTTTTCCCAGTACTGAGGGGG - Intronic
1108134709 13:47343140-47343162 GTCTTGTTCCAGTACTCAGGGGG - Intergenic
1108298367 13:49048884-49048906 GTCTCGTTCCAGTTCTCAGGGGG + Intronic
1108378299 13:49833871-49833893 CTGTAATCCCACTACTCAGGAGG + Intergenic
1108644209 13:52410058-52410080 CTGTAGTTCCAGCCATCAGGAGG + Intergenic
1108684497 13:52807029-52807051 CTGTAATCCCTGTACTCAGGAGG + Intergenic
1108831974 13:54490666-54490688 TTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1109002345 13:56821603-56821625 CTCTTGTTTCAGTTCTCAGGGGG + Intergenic
1109583261 13:64367754-64367776 CTGTGATTCCAGCACTTTGGGGG - Intergenic
1109612450 13:64784626-64784648 GTCTCGTTCCAGTTCTCAGGGGG - Intergenic
1109751849 13:66703773-66703795 CTGTAGTCCCACTACTCAGGAGG + Intronic
1110102892 13:71631974-71631996 CTGTAGTTCTGCTACTCAGGAGG + Intronic
1110340330 13:74383083-74383105 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1110375679 13:74791159-74791181 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1111295263 13:86269160-86269182 CTGTAGTCCCACTACTCAGGAGG - Intergenic
1111314894 13:86542333-86542355 CTGTAGTCCCAGCACTCGGGAGG + Intergenic
1111828166 13:93295167-93295189 CTGTAGTCCCAGTAGTCAGGAGG + Intronic
1112081353 13:95974957-95974979 CTGTAGTCCCAGTACTCGGGAGG + Intronic
1112258994 13:97861093-97861115 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1112945652 13:104923726-104923748 GTTTGGTTCCAGTTCTCAGAGGG - Intergenic
1113240629 13:108332894-108332916 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1114013266 14:18398099-18398121 CTGTGGTCCCAGTAAACAGGAGG + Intergenic
1114029582 14:18566221-18566243 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
1114501637 14:23173761-23173783 CTGTGGTCCCAGCACTAGGGAGG - Intronic
1115056884 14:29139120-29139142 CTTTAGTCCCAGCACTCAGGAGG + Intergenic
1115216091 14:31015492-31015514 CTGTAGTTCAGCTACTCAGGAGG - Intronic
1115392902 14:32873693-32873715 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1115503700 14:34073400-34073422 CTATAGTCCCACTACTCAGGAGG - Intronic
1115564109 14:34610234-34610256 CTGTGGTCTCAGTACACAGGAGG + Intronic
1115937796 14:38574317-38574339 GTATTGTTCCAGTTCTCAGGGGG + Intergenic
1115981019 14:39051704-39051726 CTGTAATCCCAGTACTCGGGAGG + Intronic
1116064240 14:39962352-39962374 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1116406386 14:44571734-44571756 ATCTTGTTCCAGTTCTCAGGAGG - Intergenic
1116528142 14:45933133-45933155 CTGTAGTCCCACCACTCAGGGGG + Intergenic
1116642197 14:47478495-47478517 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1116741396 14:48759692-48759714 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1116843843 14:49846585-49846607 CTGTGGTCCCAATCCTCAGGAGG - Intronic
1116921909 14:50587530-50587552 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1116951774 14:50884835-50884857 CTGTAATCCCAGGACTCAGGAGG - Intronic
1117111794 14:52464815-52464837 CTGTGGTCTCAGTACTTGGGAGG + Intronic
1117442670 14:55774560-55774582 CTCTAGCTCCAGTGCTCAGGAGG - Intergenic
1118278792 14:64410347-64410369 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1118372300 14:65147620-65147642 CTGTAATCCCAGTACTCAGAAGG + Intergenic
1119120566 14:72072428-72072450 CTGTAGTCCCAGCACTCAGAAGG - Intronic
1119239380 14:73046289-73046311 CTGTAATTCCATTACTTAGGAGG + Intergenic
1119289142 14:73480892-73480914 CTGTATTTCCACTACTTAGGAGG + Intronic
1119316685 14:73702260-73702282 CTGTAGTCCCAGTACTCGGGAGG - Exonic
1119317906 14:73710930-73710952 CTGTGGTCCCAGCACTAAGGTGG - Intergenic
1119352846 14:73980384-73980406 CTGTTGGTCAACTACTCAGGAGG - Intronic
1119631951 14:76240179-76240201 CTGTAGTTCAGCTACTCAGGAGG - Intronic
1119789101 14:77333143-77333165 CTGTAATCCCAGTACTCGGGAGG - Intergenic
1120798581 14:88664153-88664175 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1120987439 14:90346603-90346625 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1120999900 14:90444029-90444051 CACTGGTTCCAGCACCCAGGAGG + Intergenic
1121129273 14:91430495-91430517 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1121205779 14:92165981-92166003 CTGTAATCCCAGTACTCAGGAGG - Exonic
1121653046 14:95574106-95574128 CTGTGGTTCCATCCCCCAGGGGG + Intergenic
1121749530 14:96338354-96338376 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1122019391 14:98824530-98824552 CTGTTGTTTCAGTAATCATGTGG + Intergenic
1122343154 14:101041852-101041874 CTGTGGTCCCAGTACTTAGGAGG + Intergenic
1122942882 14:104990419-104990441 CTGTAGTCCCAGTACTCAGGAGG - Intronic
1123000097 14:105288912-105288934 TTGTGGTCCTACTACTCAGGAGG + Intronic
1123051021 14:105542508-105542530 CTGTGCTCCAGGTACTCAGGAGG - Intergenic
1123179645 14:106457430-106457452 CTGTAGTCCCAGTACTCCGGAGG - Intergenic
1123412104 15:20069038-20069060 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1123463264 15:20493933-20493955 CTGTAGTCCCACTACTCAGGGGG + Intergenic
1123521448 15:21076158-21076180 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1123654795 15:22506478-22506500 CTGTAGTCCCACTACTCAGGGGG - Intergenic
1124274107 15:28311340-28311362 CTGTAGTCCCACTACTCAGGGGG + Intronic
1124502137 15:30237892-30237914 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1124511599 15:30331950-30331972 CTGTGTTTCCTGTAGTTAGGTGG + Intergenic
1124668584 15:31616664-31616686 CTGTAATCCCAGTACTCGGGAGG - Intronic
1124699789 15:31903028-31903050 CTGTAATCCAAGTACTCAGGAGG - Intergenic
1124731315 15:32198807-32198829 CTGTGTTTCCTGTAGTTAGGTGG - Intergenic
1124741426 15:32300760-32300782 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1125007181 15:34830628-34830650 CTGTAGTCCCAGTTATCAGGAGG - Intergenic
1125047363 15:35257650-35257672 CTGTAGTTCCAGTACTCATGAGG - Intronic
1125544707 15:40494575-40494597 CTGTGGTCCCAATACTCAGGAGG - Intergenic
1125649825 15:41307427-41307449 CTGTAGTCCCACTACTCGGGAGG - Intergenic
1126184341 15:45816584-45816606 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1126224272 15:46251749-46251771 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1126253743 15:46600033-46600055 CTGTAGTCCCGCTACTCAGGAGG - Intergenic
1126516480 15:49544573-49544595 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1126566250 15:50103166-50103188 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1126577879 15:50214887-50214909 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1126669222 15:51101136-51101158 CTGTGGTTCCAGCTTTCATGAGG + Intronic
1126938467 15:53738727-53738749 CTGTAATCCCAGTACTCAGGAGG - Intronic
1127436068 15:58959431-58959453 CTGTAGTCCCGCTACTCAGGAGG - Intronic
1127860892 15:62993615-62993637 CTGTAATCCCAGTACTCGGGAGG + Intergenic
1128083711 15:64871954-64871976 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1128181596 15:65610235-65610257 CTGTGGTTCTAGTACTTGGGAGG + Intronic
1128303723 15:66583898-66583920 CTGTAGTCCCAGGACTTAGGAGG - Intronic
1128526264 15:68414426-68414448 CAGTGGTCTCAGCACTCAGGAGG - Intronic
1129000347 15:72328164-72328186 GTGAGGTTACAGAACTCAGGAGG - Intronic
1129142982 15:73618712-73618734 CTGTGGTCCCACTACTCGGGAGG + Intronic
1129155583 15:73715313-73715335 CTGTAGTCCTATTACTCAGGAGG + Intergenic
1129365196 15:75049772-75049794 CTGTGGTCCCAGAGATCAGGGGG + Exonic
1129409646 15:75342414-75342436 CTGTGGTTCCAGCACTTGGGAGG + Intronic
1130109901 15:80955366-80955388 CTGTAGTCCCAGTATTCGGGAGG + Intronic
1130126354 15:81097228-81097250 CTTCGGTCCCAATACTCAGGAGG - Intronic
1130207959 15:81895342-81895364 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1130517386 15:84636496-84636518 CTGTAATTCCAGTACTTTGGAGG + Intergenic
1130578659 15:85115796-85115818 CTGTAATCCCACTACTCAGGAGG + Intronic
1130883796 15:88076970-88076992 CTGTAGTCCCAGTACTCGGGAGG + Intronic
1131231321 15:90661721-90661743 CTGTGATCCCAGTACTTGGGAGG - Intergenic
1131301009 15:91199686-91199708 CTGAGGTTTCAGTGCCCAGGTGG + Intronic
1131418143 15:92278563-92278585 CTGTAGTCCCAGTACTTGGGAGG + Intergenic
1131819842 15:96261022-96261044 CTGTAGTTCCAGTACTCGGGAGG + Intergenic
1132014903 15:98306924-98306946 CTGTAGTCCTAGTACTCAGGAGG - Intergenic
1132402195 15:101518840-101518862 CTGTAGTCCCAGTACTCAGGAGG + Intronic
1132742719 16:1423399-1423421 CTGTGGTCCCACTACTCGGGAGG - Intergenic
1132758701 16:1498557-1498579 CTGTGTTCCCGCTACTCAGGAGG - Intronic
1132794122 16:1710349-1710371 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1132949879 16:2555412-2555434 CTGTGGTCCCACTACTCAGGAGG + Intronic
1132964469 16:2644755-2644777 CTGTGGTCCCACTACTCAGGAGG - Intergenic
1133204236 16:4223497-4223519 CTGTAGTCCCACTACTCGGGAGG - Intronic
1133292603 16:4732558-4732580 CTGTAGTCTCAGTACTCAGGAGG + Intronic
1133437864 16:5795423-5795445 CTGTGGTCCCACTACTCGGGAGG - Intergenic
1133688130 16:8186614-8186636 CTATGGATCCAGCACTCAGTAGG + Intergenic
1133808995 16:9146767-9146789 CTGTGGTCCCAGCACTTGGGAGG + Intergenic
1134068039 16:11241972-11241994 CTGTAGTCCCAATACCCAGGAGG - Intergenic
1134130817 16:11648776-11648798 CTGTAATCCCAGTTCTCAGGAGG + Intergenic
1134263160 16:12670171-12670193 CTGTGGTCCTAGATCTCAGGAGG + Intronic
1134569397 16:15278644-15278666 CTGTAATCCCAGTACTCTGGAGG - Intergenic
1134732979 16:16477405-16477427 CTGTAATCCCAGTACTCTGGAGG + Intergenic
1134766439 16:16762939-16762961 CTGTAGCTCCAGCACTCAGGGGG - Intergenic
1134810970 16:17166768-17166790 CTGTGGTCCCAGCACTTTGGAGG - Intronic
1134934458 16:18234566-18234588 CTGTAATCCCAGTACTCTGGAGG - Intergenic
1135123485 16:19786574-19786596 CTGTAGTCCCACTACTCAGGAGG + Intronic
1135436396 16:22429488-22429510 CTGTGGTTCCAGTTCCTCGGGGG - Intronic
1135555191 16:23430304-23430326 CTGTAGTCCCAGTACTCAGGAGG + Intronic
1135602247 16:23793392-23793414 CTGTAGTCCCACTACTCAGGAGG - Intergenic
1135661858 16:24303794-24303816 CTGTGGTCCAGCTACTCAGGAGG + Intronic
1135766349 16:25180686-25180708 CTGTGGTTCAGTTACTCAGGAGG - Intergenic
1136091884 16:27926565-27926587 CTGTGATCCCACTACTCTGGGGG + Intronic
1136108396 16:28048104-28048126 CTTTAGTCCCACTACTCAGGAGG + Intronic
1136471620 16:30484484-30484506 CTGTAATCCCACTACTCAGGAGG + Intronic
1136594317 16:31237178-31237200 CTGCAGTCCCAGTACTCAGGAGG - Intergenic
1137063494 16:35812944-35812966 CTCTGGTTCCACTTCTCAGCAGG + Intergenic
1137243237 16:46677656-46677678 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1137288674 16:47037318-47037340 CTGTGGTCCCAGCACTTTGGAGG - Intergenic
1137289035 16:47039092-47039114 CTGTAGTTCCAGCACTTTGGAGG - Intergenic
1137539803 16:49354509-49354531 CTGTAGTGCCACTACTCAGGAGG + Intergenic
1137632986 16:49960543-49960565 CTGTAATCCCACTACTCAGGAGG - Intergenic
1138014556 16:53416842-53416864 CTGTAGTTCCAGTACTTGGGAGG + Intergenic
1138342534 16:56299642-56299664 CTGAGGTTTCAGTGATCAGGAGG - Intronic
1138368155 16:56500501-56500523 CTGTGGTCCCAGTACTCAGGAGG + Intronic
1138372911 16:56541489-56541511 CTGTAATCCCATTACTCAGGAGG + Intergenic
1138397844 16:56719718-56719740 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1138468342 16:57210589-57210611 CTGTAATCCCAGTACTCAGGAGG + Intronic
1138562367 16:57809415-57809437 CTGTAGTTCCAGTACACGGGAGG - Intronic
1139131499 16:64152036-64152058 CTGTGGTGCTAGGATTCAGGAGG - Intergenic
1139135844 16:64204041-64204063 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1139485223 16:67252326-67252348 CTGTAGTCCCCGTACTCAGGAGG + Intronic
1139518596 16:67466405-67466427 CTGTAATCCTAGTACTCAGGAGG + Intronic
1139632821 16:68240705-68240727 CTGTAATCCCACTACTCAGGAGG - Intergenic
1139639495 16:68280854-68280876 CTGTTGTCCCAGCACTCAGGAGG - Intronic
1139679133 16:68546632-68546654 CTGTAGTCCCAGTTCTCAGGAGG - Intronic
1140193472 16:72837720-72837742 CTGTAGTTCTGCTACTCAGGAGG - Intronic
1140324590 16:73989423-73989445 CTGTAGTCCCAGCACTCAGGTGG + Intergenic
1140384596 16:74524085-74524107 CTGTAATCCCAGCACTCAGGTGG + Intronic
1140388518 16:74564041-74564063 TGGTAGTTCCACTACTCAGGAGG - Intronic
1140485120 16:75287654-75287676 CTGTAGTCCCAGCACTCAAGAGG + Intergenic
1141077092 16:81016638-81016660 GTGTAATTCCAGTACTCGGGAGG + Intronic
1141104933 16:81225803-81225825 CTGTAATCCCATTACTCAGGAGG + Intergenic
1141990892 16:87608913-87608935 CTGTGGTCCCACCACTCAGGAGG + Intronic
1142045607 16:87923309-87923331 CTGTGGTTCCAGTTCCTCGGGGG - Intronic
1142389345 16:89788538-89788560 CTGTAATTCCAGTACTTCGGGGG + Intronic
1142607943 17:1092270-1092292 ATGTGGTTCTAGGACTCAGAAGG + Intronic
1142829221 17:2535178-2535200 CTGTAGTCCCACTAATCAGGAGG + Intergenic
1142939340 17:3369305-3369327 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1143182499 17:4992402-4992424 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1143714842 17:8759502-8759524 CTGTGGTCCCAGTACTTGGGAGG + Intergenic
1143794780 17:9327795-9327817 CTGTAGTCCCAGTATTCAGGAGG - Intronic
1143801614 17:9387415-9387437 CTGTAGTCCCATTACTCGGGAGG - Intronic
1143853171 17:9828076-9828098 CTGTGGTACCAGGTCTCATGAGG + Intronic
1144259671 17:13505899-13505921 CTGTAATCCCAGTACTCAGGAGG + Intronic
1144745919 17:17614395-17614417 CTGTGGTCCCAGCACTTGGGAGG - Intergenic
1145919885 17:28602710-28602732 CTGTAATCCCAGTACTCAGGAGG - Intronic
1145969108 17:28945136-28945158 CTGTGGTCCCACTACTTGGGAGG + Intronic
1145985840 17:29045664-29045686 CTGTAATCCCAGTACTTAGGGGG - Intronic
1146277372 17:31524229-31524251 CTGTGGCTTCAGACCTCAGGGGG - Intronic
1146362713 17:32190915-32190937 CTGTAGTCCCAGTACTTGGGAGG - Intronic
1146487585 17:33256583-33256605 CTGTTTTTCCAGCACTGAGGTGG + Intronic
1146744760 17:35318496-35318518 GTTTTGTTCCAGTTCTCAGGAGG + Intergenic
1147342771 17:39764340-39764362 TTGTTGTCCCAGTACTCAAGAGG + Intergenic
1147540900 17:41358688-41358710 CTGTAGTCCCATTACTCAGGAGG + Intergenic
1147652438 17:42070220-42070242 CTGTAGTCCCACTACTCAGGAGG + Intergenic
1147748422 17:42710751-42710773 CTGTAGTCCTAGTACTCAGGAGG - Intronic
1147850441 17:43438493-43438515 CTGTAGTCCCAGTACTCGGGGGG - Intergenic
1147860240 17:43516569-43516591 CTGTAGTCCCAGTATTCAGGAGG - Intronic
1148030232 17:44614844-44614866 CTGTGGTCCAGCTACTCAGGAGG - Intergenic
1148137657 17:45305217-45305239 CTGTAGTCCCGCTACTCAGGAGG - Intronic
1148636816 17:49155184-49155206 CTGTGGTCCCAGTACTCGTGAGG + Intronic
1148932003 17:51134639-51134661 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1149126499 17:53240975-53240997 CTGTAATTCTAGCACTCAGGTGG + Intergenic
1149674249 17:58445320-58445342 CTGTAGTCCCAGTACTTGGGAGG + Intronic
1149733891 17:58974004-58974026 CTGTAGTCCTAGTACACAGGAGG + Intronic
1149749770 17:59134671-59134693 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1150131401 17:62671191-62671213 CTGTGGTCCCGCTACTCAGGAGG - Intronic
1150153345 17:62829289-62829311 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1150219070 17:63485651-63485673 CTGTAGTCCCAGTACTCAGGAGG + Intronic
1150332501 17:64305597-64305619 CTGTGGACCCGCTACTCAGGAGG + Intergenic
1150535254 17:66032121-66032143 CTGTAATTCCAATACTCAGATGG - Intronic
1150606817 17:66698856-66698878 CTGTAGTGCCAGTACTCGGGAGG + Intronic
1150676528 17:67248932-67248954 CTGTGGTGCCAGCATTCGGGAGG - Intergenic
1150741125 17:67779708-67779730 CTGTGGTCCCAGCACTTGGGAGG - Intergenic
1150773928 17:68064173-68064195 CTGTAATCCCACTACTCAGGAGG - Intergenic
1150800385 17:68277251-68277273 CTGTAATCCCAGCACTCAGGAGG - Intronic
1151487514 17:74410547-74410569 CTGTAGTCCCACTACTCAGGAGG + Intergenic
1151806578 17:76409516-76409538 CTGTAATCCCACTACTCAGGAGG - Intronic
1151832637 17:76563904-76563926 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1152017156 17:77758167-77758189 CTGGGGTTCCAACGCTCAGGTGG + Intergenic
1152173910 17:78773505-78773527 CTGTAATTCCGCTACTCAGGAGG + Intronic
1152193440 17:78902501-78902523 CTGTGGCCCCAGTATTCGGGTGG - Intronic
1152396055 17:80034320-80034342 CTGTAATCCCAGTACTCAGGAGG - Intronic
1152674350 17:81630407-81630429 CTGTGGTTCCAGCTCTCGGGAGG - Intronic
1153078994 18:1198222-1198244 CTGTAGTTCCAGTACTCAGGAGG - Intergenic
1153168597 18:2290002-2290024 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1153181017 18:2433483-2433505 CTGTGGTTTCATTACTCTGCCGG - Intergenic
1153298507 18:3571468-3571490 CTGTGTCTCAACTACTCAGGGGG - Intronic
1153532679 18:6064918-6064940 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1153576677 18:6528707-6528729 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1153620149 18:6969667-6969689 ATGTGGTTCTACTACTCAGCTGG + Intronic
1153693403 18:7616278-7616300 CTGTAGTCCATGTACTCAGGAGG - Intronic
1153753644 18:8259069-8259091 CTGTAGTTCCAGCTTTCAGGAGG - Intronic
1154016529 18:10623546-10623568 CTGTGGTTCCAGCTACCAGGGGG - Intergenic
1154090324 18:11353158-11353180 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1154188982 18:12212117-12212139 CTGTGGTTCCAGCTACCAGGGGG + Intergenic
1154235386 18:12600844-12600866 CTGTGGTCCTTGTACTCTGGAGG - Intronic
1154524476 18:15269008-15269030 TTGTGGTCCCAGTAAACAGGAGG - Intergenic
1155092768 18:22527432-22527454 TTGTAATCCCAGTACTCAGGAGG + Intergenic
1155193953 18:23455512-23455534 CTGTGGTCCCACTACTCGGGAGG - Intronic
1155522215 18:26679908-26679930 CTGTAGTCTCAGTACTCAGGAGG + Intergenic
1156324091 18:36057488-36057510 CTATAGTCCCAGTACTCAGGGGG + Intronic
1156438336 18:37157685-37157707 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1157124983 18:44947760-44947782 CTGTAGTTCCAGTACTTGGGAGG - Intronic
1157844330 18:50988879-50988901 CTGTGGTCCAGCTACTCAGGAGG + Intronic
1157868604 18:51208673-51208695 CTGTGGTCCAGTTACTCAGGAGG + Intronic
1158800747 18:60905641-60905663 CTGTGATTCTGGTACTCAGTTGG + Intergenic
1159052451 18:63434100-63434122 CTGTAATCCCAGTTCTCAGGAGG - Intergenic
1159347943 18:67231479-67231501 CTGTAGTCCCAGTACTCCGGAGG - Intergenic
1160094673 18:75860593-75860615 CTGTAATTCCACTACTCAGGAGG + Intergenic
1160184885 18:76668203-76668225 CTGTAGTCCCAGTACTCCAGAGG + Intergenic
1160682161 19:416885-416907 CTGTGCACCCAGTCCTCAGGTGG + Exonic
1160709306 19:543720-543742 CTGTAGTCCCACTACTCGGGAGG + Intergenic
1161089374 19:2352497-2352519 CTGTGGTTCCAGTGCCGAGCTGG + Intronic
1161243983 19:3238806-3238828 CTGTAATCCCAGTACTCAGGAGG + Intronic
1161295485 19:3517954-3517976 CTGTAGTCCCAGGACTCAGGAGG - Intronic
1161332142 19:3693457-3693479 TGGTGGTGCCAGTACTCATGGGG - Intronic
1161355573 19:3817632-3817654 CTGTAGTTCCAGTACTTGGAAGG + Intronic
1161514248 19:4687917-4687939 CTGTAGTCCCACTACTCGGGAGG - Intronic
1161604402 19:5206688-5206710 CTGGGGGTCCAGGCCTCAGGAGG + Exonic
1161795873 19:6386564-6386586 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1161818121 19:6512689-6512711 CTGTGGTCCCGCTACTCTGGAGG + Intergenic
1161862686 19:6810055-6810077 CTGTAGTCCCAACACTCAGGAGG + Intronic
1161910143 19:7187337-7187359 CTGTAATTCCAGTACTTTGGGGG - Intronic
1161919257 19:7253905-7253927 CTGTAATCCCAGCACTCAGGAGG + Intronic
1161939267 19:7392591-7392613 CTGTAATTCCAGCACTCGGGAGG + Intronic
1162080205 19:8213419-8213441 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1162480635 19:10924973-10924995 CTGTAATTCCAGCACTTAGGAGG + Intronic
1162499848 19:11046551-11046573 CTGTGCTTCCAGCACTCAGGAGG - Intronic
1162514722 19:11141079-11141101 CTGTAGTCCCAGACCTCAGGGGG + Intronic
1162607148 19:11718156-11718178 CTGTAATCCCACTACTCAGGAGG - Intergenic
1162667784 19:12229733-12229755 CTGTAGTCCCAGTACTTGGGAGG - Intronic
1162828390 19:13268553-13268575 CTGTAGTCCCAGCACTCGGGAGG - Intronic
1162832852 19:13297950-13297972 CTGTATTCCCACTACTCAGGAGG - Intronic
1162875764 19:13619796-13619818 CTGTGGTCCCAGCTCTCGGGAGG - Intronic
1163055026 19:14711543-14711565 CTGTGGTCTCGCTACTCAGGAGG + Intronic
1163385035 19:16994638-16994660 CTGTGGTCCCAGCTATCAGGAGG - Intronic
1163596748 19:18225133-18225155 CTGTGGTTCCATGACGCGGGCGG + Intronic
1163619817 19:18352320-18352342 CTGTAATCCCAGTACTCGGGAGG + Intronic
1164013085 19:21225724-21225746 CTGTAGTCCCAGTACTCAGGAGG - Intronic
1164225185 19:23238783-23238805 CTGTAATCCCACTACTCAGGAGG + Intronic
1164248963 19:23460207-23460229 ATGTGGATCCAGTCCACAGGTGG + Intergenic
1164282155 19:23778469-23778491 CTGTAATCCCAGTACTCTGGGGG - Intronic
1164422708 19:28110396-28110418 GTCTTGTTCCAGTACTCAGGGGG - Intergenic
1164600731 19:29561686-29561708 CTGTGGGTGAAGTACCCAGGAGG + Intronic
1164627033 19:29736541-29736563 CTGTAATTCCAGTACTCAGGAGG + Intergenic
1164797882 19:31049610-31049632 CTCTGATTCCAGTTCTCAGGGGG + Intergenic
1164847224 19:31442947-31442969 CTGTGGTCCCAGGACTCAGGAGG + Intergenic
1165207652 19:34204594-34204616 CTGTAGTCCTAGCACTCAGGAGG + Intronic
1165483907 19:36083750-36083772 CAGTGGCTCCAATACCCAGGTGG - Intronic
1165534615 19:36433098-36433120 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1165594422 19:37000182-37000204 CTGTAGTCCCAGTAGTCAGGAGG + Intergenic
1165715025 19:38039003-38039025 CTGTGGTCCAGCTACTCAGGAGG - Intronic
1165752592 19:38269730-38269752 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1165836893 19:38763309-38763331 CTGTAATCCCAGCACTCAGGAGG + Intronic
1165847778 19:38829692-38829714 TGGTGGTCCCAGTACTCGGGAGG + Intronic
1165861118 19:38909992-38910014 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1165877991 19:39023191-39023213 CTGTAATCCCAGTACTCTGGGGG - Intronic
1165891404 19:39114552-39114574 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1166009613 19:39932817-39932839 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1166055789 19:40287667-40287689 CTGTGGTCCCAGTACTTGGGAGG - Intergenic
1166093660 19:40526292-40526314 CTGTGATCCCAGTACTCAGGAGG - Intronic
1166480350 19:43166721-43166743 CTGTAATCCCAGTACTCGGGAGG + Exonic
1167054476 19:47100818-47100840 CAGTAATCCCAGTACTCAGGAGG - Intronic
1167489872 19:49786432-49786454 CTGCAGTTCCAGTGCTCTGGGGG + Intronic
1167835866 19:52069193-52069215 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1168234175 19:55051550-55051572 CTGTAATCCCAGTACTCGGGAGG - Intronic
1168478876 19:56700118-56700140 ATGTAGTTCCAGGACTCCGGGGG + Intergenic
1168599042 19:57703361-57703383 CTGTAGTCCCAGGACTCAGGAGG + Intronic
925379135 2:3412437-3412459 CTGTAATCCCAGTACTCAGGAGG + Intronic
925447652 2:3941608-3941630 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
925795385 2:7536065-7536087 TTCTTGTTCCAGTTCTCAGGGGG + Intergenic
925881789 2:8358866-8358888 CTGTAGTCCCACTACTCAGGAGG + Intergenic
926022020 2:9504638-9504660 CTGTAGTCCCACTACTCAGGAGG + Intronic
926235206 2:11036670-11036692 TTGTTGTTCCAGTTCTCAGGGGG + Intergenic
926241015 2:11085221-11085243 CTGTAGTCCCAGCACCCAGGAGG - Intergenic
926898938 2:17728311-17728333 CTGTAGTACCAGCTCTCAGGAGG + Intronic
927327265 2:21819369-21819391 CTGTAATCCCACTACTCAGGAGG + Intergenic
927355572 2:22169190-22169212 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
927370157 2:22345072-22345094 CTGTGGTCCAGTTACTCAGGAGG + Intergenic
927549438 2:23985021-23985043 CTGTAGTTCTACAACTCAGGAGG - Intronic
927722422 2:25393304-25393326 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
927734158 2:25503369-25503391 CTGTGGTCCTACTACTCAGGAGG + Intronic
927829212 2:26333940-26333962 CTGTAATCCCAGTACTCAGGAGG - Intronic
927838697 2:26422796-26422818 CTGTAGTCCCAGTACTCAGGAGG + Intronic
928110480 2:28504618-28504640 CTGTAGTCCCGATACTCAGGAGG + Intronic
928147891 2:28796844-28796866 CTCTTGTTCCAGTTCTCAAGGGG + Intronic
928554694 2:32411598-32411620 CTGTAGTCCCACTGCTCAGGAGG - Intronic
928608542 2:32968087-32968109 CTGTAGTCCCAGCACTCAGAAGG - Intronic
928988797 2:37208715-37208737 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
929162502 2:38846494-38846516 CTGTAGTTCAGCTACTCAGGAGG + Intronic
930134731 2:47890545-47890567 CTGTAATCCCAGCACTCAGGAGG + Intronic
930664639 2:54090021-54090043 CTGTAATCCCAGTACTCAGGAGG + Intronic
930725830 2:54680536-54680558 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
930924465 2:56800197-56800219 CTGTAATCCCAGCACTCAGGAGG - Intergenic
931021732 2:58052479-58052501 GTGTAGTCCCAGTACTCAGGAGG + Intronic
931437625 2:62262628-62262650 CTGTAGTGCCATTACTCGGGAGG - Intergenic
931444302 2:62314017-62314039 CTGTGGTCACAATACTCAGGGGG - Intergenic
931750118 2:65323114-65323136 CTGTGGTCCAGCTACTCAGGAGG - Intronic
931754942 2:65364584-65364606 CTTTGGTTACAGTACACAGAGGG - Intronic
931834960 2:66089324-66089346 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
932337832 2:70941037-70941059 CTGTGGTCCCAGCTCTCAGGAGG - Exonic
932715992 2:74101088-74101110 CTTTGGGGACAGTACTCAGGAGG + Exonic
932837471 2:75050853-75050875 CTATGGATCCAGTACACAGCGGG - Intronic
933715372 2:85355818-85355840 CTGGGGTGCCAGGACTAAGGGGG + Intronic
934111051 2:88743106-88743128 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
934508847 2:94920207-94920229 CTGTGATTCCAGCACTTGGGAGG + Intergenic
934690047 2:96351544-96351566 CTGTAGTCCCACTACTCTGGAGG + Intronic
934877944 2:97943124-97943146 CTGTATTCCCACTACTCAGGAGG + Intronic
934898358 2:98138522-98138544 CTGTGCTTCCTGGGCTCAGGGGG - Intronic
934982397 2:98854157-98854179 CTGTAGTCCCAGTATTCGGGAGG + Intronic
935001037 2:99015571-99015593 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
935014075 2:99163447-99163469 CTGTAGTCCCACTACTCGGGAGG - Intronic
935077762 2:99762244-99762266 CTGTAGTCCCAGGACTCAGGAGG - Intronic
935733338 2:106084722-106084744 CTGTGATCCCAGTACTTTGGAGG - Intergenic
935774762 2:106463351-106463373 CTGTAATCCCACTACTCAGGAGG + Intronic
935905306 2:107832561-107832583 CTGTAATCCCACTACTCAGGAGG - Intronic
935991669 2:108724282-108724304 CTGTAATCCCACTACTCAGGAGG - Intronic
936106941 2:109632695-109632717 CTGTAGTCCGAGTACTCAGGAGG + Intergenic
936381375 2:111989476-111989498 CTGTAGTCCCAGTACTCGGGAGG - Intronic
936580793 2:113698844-113698866 CTGGGGGTCCAGTTCACAGGTGG - Intergenic
936633677 2:114232222-114232244 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
936704902 2:115060468-115060490 CTGTAGTCCCAGCACTCGGGAGG + Intronic
937108006 2:119337175-119337197 CTGTAGTGCCAGCACTCAGGAGG - Intronic
937411029 2:121675769-121675791 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
937413023 2:121692936-121692958 CTGTAATCCCACTACTCAGGAGG - Intergenic
937699222 2:124845046-124845068 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
937708395 2:124949031-124949053 CTGTAGTCCCAGTACTGGGGAGG - Intergenic
938385925 2:130867358-130867380 CTGTAATCCCAGTACTCAAGAGG - Intronic
938523660 2:132101126-132101148 CTGTGGTCCCAGTAAACAGGAGG - Intergenic
938855594 2:135307186-135307208 CTGTGGTCCCACTACTCAGGAGG - Intronic
938960774 2:136339148-136339170 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
939305577 2:140406265-140406287 ATCTTGTTCCAGTTCTCAGGGGG - Intronic
939449525 2:142355513-142355535 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
940282677 2:152003964-152003986 CTGTGGTCCGAGTACTTGGGAGG - Intronic
940706599 2:157112625-157112647 ATCTTGTTCCAGTTCTCAGGGGG - Intergenic
940802584 2:158149356-158149378 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
941257737 2:163254500-163254522 CTGCAGTTCCAGTATGCAGGAGG + Intergenic
941358301 2:164519431-164519453 TTCTTGTTCCAGTTCTCAGGGGG - Intronic
941419751 2:165268608-165268630 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
941512388 2:166428414-166428436 CTTTGATTCCAGTTCTTAGGTGG + Intronic
941520483 2:166536329-166536351 CTATGGTTCCTATAATCAGGGGG + Intergenic
941814148 2:169783678-169783700 CTGTAGTCCCAGTATTGAGGAGG + Intergenic
942405688 2:175651933-175651955 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
942569492 2:177298846-177298868 CTGTAGTCCCGCTACTCAGGAGG + Intronic
943052723 2:182936134-182936156 CTGTGGTCCTAGTACTTGGGAGG + Intronic
943282889 2:185960241-185960263 ATCTTGTTCCAGTTCTCAGGGGG - Intergenic
943644104 2:190389598-190389620 CTGCGGTTGCAGCACTCAGGAGG + Intergenic
944029488 2:195216946-195216968 CTGTAGTCCCAGCACTCAGAAGG - Intergenic
944153222 2:196584228-196584250 CTGTGGTAAAAGTACTGAGGTGG + Intronic
944234857 2:197432742-197432764 CTGCGATACTAGTACTCAGGAGG + Intronic
944328430 2:198435622-198435644 CTGTTGGTTCAGTACTTAGGGGG + Intronic
944388403 2:199190220-199190242 CTGTAGTCCCAGTACTCTGGAGG - Intergenic
945521151 2:210829039-210829061 GTCTTCTTCCAGTACTCAGGGGG + Intergenic
945545303 2:211142933-211142955 GTCTGGTTCCAGTTCTCAGAGGG + Intergenic
945805507 2:214485195-214485217 CTGTAGTCCCACTACTCAGGTGG + Intronic
945996839 2:216444638-216444660 CTGTAATCCCACTACTCAGGAGG - Intronic
946250726 2:218410358-218410380 CTGTAATCCCAGTACTCGGGAGG - Intergenic
946323580 2:218969625-218969647 CTGTAGTTCCAGTACTCGGGAGG - Intergenic
946636060 2:221728405-221728427 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
946667370 2:222065273-222065295 CTGTGATTCCAGCACTTTGGGGG + Intergenic
946749074 2:222874848-222874870 CTGTAATCCCAGTACTCAGGAGG + Intronic
946824387 2:223661724-223661746 GTCTGGTTCCAGTTCTTAGGGGG - Intergenic
946844482 2:223847312-223847334 CTGTGGACACAGTCCTCAGGAGG + Intergenic
946845513 2:223855368-223855390 CTGTAATCCCAGCACTCAGGAGG + Intergenic
946873793 2:224108354-224108376 CTGTCCTCCCAGTGCTCAGGTGG + Intergenic
947015160 2:225611246-225611268 CTCTGGTTGCAGTACAGAGGAGG - Intronic
947146624 2:227072968-227072990 CTCTTGTTCCTGTTCTCAGGGGG - Intronic
947265861 2:228280009-228280031 CTGTGGTCCCACTACTCTGGAGG + Intergenic
947400354 2:229725495-229725517 CTGTGGTCCCACTTCTCGGGAGG + Intergenic
947428311 2:230003857-230003879 CTCTGCTTCCAGGACTCTGGTGG + Intronic
947522396 2:230857297-230857319 CTGTAGTCCCAGTACTTTGGAGG + Intergenic
947621883 2:231596038-231596060 CTGTAATCCCAGTACTCAGGAGG - Intergenic
947770275 2:232665031-232665053 CTGTGGTCCAGCTACTCAGGAGG - Intronic
947789202 2:232853397-232853419 CTGTAGTCCCAGCACTCGGGAGG - Intronic
947977170 2:234376884-234376906 CTGTAGTCCCAGTACTGGGGAGG - Intergenic
948416040 2:237804918-237804940 GTCTTGTTCCAGTTCTCAGGAGG - Intronic
948497395 2:238360756-238360778 CTGTAGTCCCAGCACTCAGGAGG + Intronic
949039293 2:241839626-241839648 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1168834719 20:870404-870426 CTGTAATCCCATTACTCAGGAGG + Exonic
1168907021 20:1413541-1413563 CTGTAATCCCACTACTCAGGAGG + Intergenic
1169474402 20:5918023-5918045 CTGTAATCCCACTACTCAGGAGG + Intronic
1169969766 20:11256960-11256982 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1170200508 20:13738433-13738455 CTGTGGTCCCACTACTCAGGAGG - Intronic
1170643442 20:18176177-18176199 CTGTAGTCCCACTACTCAGGAGG + Intronic
1170822969 20:19769778-19769800 CTGTGTTTCAAGACCTCAGGAGG + Intergenic
1170856329 20:20059204-20059226 CTGTAGTCCCACTACTCGGGAGG + Intronic
1170865691 20:20154278-20154300 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1171375204 20:24688637-24688659 TTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1171721342 20:28566241-28566263 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1171756728 20:29117318-29117340 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1171862776 20:30416581-30416603 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1171987241 20:31668986-31669008 GTGTAGTTCCTGTAATCAGGAGG - Intronic
1172023512 20:31932738-31932760 CTGTGATCCCAGCACTCTGGAGG + Intronic
1172392394 20:34574696-34574718 CTGTGGTTCCAGCACCCATAGGG - Intronic
1172551649 20:35805158-35805180 CTGTGGTCCCAGCACTCAGGAGG - Intronic
1172724477 20:37027223-37027245 CTGTGGTCCTACTACTCAGGAGG + Intronic
1172735315 20:37122517-37122539 CTGTGGTTCAGCTACGCAGGAGG + Intronic
1172989377 20:39021602-39021624 CTGTGGTCCAGCTACTCAGGAGG - Intronic
1173037146 20:39423288-39423310 CTGTGGTCCAGCTACTCAGGAGG - Intergenic
1173075769 20:39817911-39817933 CTGTGGCTTCAGTGCTCTGGTGG - Intergenic
1173494818 20:43510978-43511000 CTGTAATCCCAGTACTCTGGAGG - Intronic
1173963725 20:47094908-47094930 CTGTAGTCCCACTACTCAGGAGG + Intronic
1173975205 20:47181628-47181650 CTGTAGTCCCAGTACTTTGGGGG - Intronic
1174038310 20:47681805-47681827 CTGTAATCCCAGCACTCAGGAGG - Intronic
1174593033 20:51661483-51661505 CTGTGGTCCCGGTATTCAGAAGG - Intronic
1174808390 20:53624798-53624820 CTGTAATCCCAGTACTCGGGAGG + Intergenic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1174905831 20:54549937-54549959 CTGTAATTACAGTTCTCAGGTGG + Intronic
1175262772 20:57685081-57685103 CTCTGGTTACAGTACTTGGGAGG - Intronic
1175351338 20:58321920-58321942 CTGTGGTCCTATTATTCAGGAGG - Intronic
1175564158 20:59959520-59959542 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1175603625 20:60295148-60295170 CTGTAGTCCAACTACTCAGGTGG + Intergenic
1175617756 20:60416407-60416429 GTCTGGTTCCAGTTCTTAGGAGG + Intergenic
1176269397 20:64227841-64227863 CTGCGGTTCCAGCACTAAGGTGG + Intronic
1176284061 20:64333627-64333649 ACGTTGTTCCAGTTCTCAGGGGG + Intergenic
1176677500 21:9793218-9793240 CTGTGCTTCCAGTAATCACAGGG + Intergenic
1176772969 21:13099470-13099492 CTGTGGTCCCAGTAAACAGGAGG + Intergenic
1176865234 21:14046995-14047017 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1176968369 21:15237356-15237378 CTGTGGTTCCGCTACTTGGGAGG - Intergenic
1177502685 21:21978493-21978515 CTATGATCCCACTACTCAGGAGG - Intergenic
1177661502 21:24089516-24089538 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1177744780 21:25198443-25198465 CTGTAATTCCAGTACTTGGGAGG - Intergenic
1178300287 21:31447312-31447334 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1178426457 21:32482783-32482805 CAGTGGTTCCAGAACACAAGAGG - Intronic
1178858442 21:36269640-36269662 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1178872881 21:36390775-36390797 CTCTGGTCCCACTACGCAGGAGG - Intronic
1179161047 21:38899709-38899731 ATGTGGTTTTACTACTCAGGAGG - Intergenic
1179216247 21:39369472-39369494 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
1179268545 21:39828410-39828432 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1179680802 21:43020052-43020074 CTGTAGTCCCACTACTCAGGAGG - Intronic
1180191068 21:46162706-46162728 CTGTAGTCCCACTACTCTGGAGG - Intronic
1180257106 21:46637830-46637852 CTGTAGTTCAGCTACTCAGGAGG + Intronic
1180294885 22:10924900-10924922 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1180413781 22:12641161-12641183 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1180437763 22:15328912-15328934 CTGTGGTCCCAGTAAACAGGAGG + Intergenic
1180453698 22:15493271-15493293 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
1180520611 22:16199191-16199213 CTGTGGTCCCAGTAAACATGAGG + Intergenic
1180730235 22:17975926-17975948 CTGTAATCCCACTACTCAGGAGG + Intronic
1180788396 22:18559486-18559508 CTGTAGTTCCGCTACTCCGGAGG + Intergenic
1180894675 22:19321199-19321221 CTGTAGTCCCAGTACTTACGAGG + Intergenic
1181227177 22:21399507-21399529 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1181233342 22:21435832-21435854 CTGTAGTTCCGCTACTCCGGAGG - Intronic
1181245308 22:21499011-21499033 CTGTAGTTCCGCTACTCCGGAGG + Intergenic
1181523963 22:23467808-23467830 GTCTTGTTCCAGTCCTCAGGGGG - Intergenic
1181768239 22:25107594-25107616 CTGTAGTCCCAGTACTCTGGAGG - Intronic
1181976468 22:26734294-26734316 CTGTGGTTCCAGTACCCATGAGG + Intergenic
1181979252 22:26754167-26754189 CTGGAGTTCCAGTCCACAGGTGG - Intergenic
1182340142 22:29613879-29613901 CTGTAGTCCAGGTACTCAGGAGG - Intronic
1182498524 22:30728271-30728293 CTGTGGTCCCAGCACTCGGGAGG + Intronic
1182600579 22:31460508-31460530 CTGTAGTTCCGCTACTCCGGAGG + Intronic
1182618668 22:31605724-31605746 CTGTGGTTCAGGTACTTGGGAGG + Intronic
1182643236 22:31786132-31786154 CTGTAATCCCACTACTCAGGAGG + Intronic
1182739840 22:32559706-32559728 CTGTAGTCCCAGCACTCTGGAGG + Intronic
1183567463 22:38625819-38625841 CTGTAATCCCAGTACTCAGGAGG + Intronic
1184107064 22:42373923-42373945 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
1184480061 22:44741185-44741207 CTGTAGTCCCAATACTCTGGAGG + Intronic
1184579720 22:45407581-45407603 CTATAGTCCCAGTACTTAGGAGG - Intronic
1184958663 22:47912429-47912451 CTGTAGTCCCAGCACTCAGGAGG - Intergenic
949394803 3:3603221-3603243 CGGTAGTCCCACTACTCAGGCGG + Intergenic
949814593 3:8044629-8044651 GTGTTGTTCCAGTTCTCAGGGGG - Intergenic
950463114 3:13137012-13137034 CTGTGGTCCCTGTATTCGGGAGG + Intergenic
950841351 3:15970902-15970924 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
950963955 3:17133101-17133123 CTGTAATCCCAGTACTCAGGAGG + Intergenic
951203006 3:19895357-19895379 CTGTAGTCCCACTACTCGGGAGG + Intronic
951756262 3:26094888-26094910 CTGTAGTCCCAGTACTCGGGAGG + Intergenic
951766988 3:26210981-26211003 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
951896752 3:27616795-27616817 CTGTAGTTCCAGTACTTGGGAGG - Intergenic
952265439 3:31781385-31781407 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
952320148 3:32269571-32269593 CTGTGGAACAAGAACTCAGGTGG + Intronic
952325028 3:32313276-32313298 CTGTTCTCCCAGTGCTCAGGTGG - Intronic
952380613 3:32801566-32801588 CTGTAGTCCCAGTACTTTGGGGG - Intergenic
952434863 3:33263079-33263101 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
952456866 3:33480957-33480979 CTGCAGTCCCACTACTCAGGAGG - Intergenic
952592933 3:34979258-34979280 CTGTAGTCCCAGTACTCGGGAGG + Intergenic
952987454 3:38798909-38798931 CTGTAGTTCCACTACTTGGGAGG - Intergenic
953277067 3:41512202-41512224 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
953971312 3:47349914-47349936 GTGTAGTCCCACTACTCAGGAGG - Intergenic
954037425 3:47859005-47859027 CTGTAGTCCCAGTACTCGGGAGG + Intronic
954242014 3:49301195-49301217 CTGCGGTTCCAGCACTTTGGAGG - Intronic
954274407 3:49532993-49533015 CTCTGGTTGGGGTACTCAGGAGG - Exonic
954478839 3:50777979-50778001 ATCTTGTTCCAGTTCTCAGGGGG + Intronic
954479523 3:50785386-50785408 GTCTTGTTCCAGTTCTCAGGTGG + Intronic
954571281 3:51643155-51643177 CTGTAGTCCCAGTACTTGGGAGG - Intronic
954585943 3:51736949-51736971 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
954605667 3:51907228-51907250 CTGTAATCCCACTACTCAGGAGG + Intergenic
955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG + Intronic
955188674 3:56739520-56739542 CTGTGGTCCCAGCTATCAGGAGG - Intronic
955400094 3:58585449-58585471 CTGTGGTTCCAGTAACTGGGTGG + Intronic
955698030 3:61656108-61656130 CTGTAGTCCCACTTCTCAGGAGG + Intronic
955698207 3:61657515-61657537 CTGTAGTCCCACTACTCAGGAGG + Intronic
955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG + Intergenic
956217174 3:66860622-66860644 CTGTAGTCCCGCTACTCAGGAGG - Intergenic
956440138 3:69272263-69272285 CTGTAGTTCCAATACTCAGGAGG - Intronic
956463994 3:69500657-69500679 CTGTGGTTCCAGTTCTTACCAGG - Intronic
957680913 3:83433172-83433194 CTGTAGTTCCACTACTAGGGAGG - Intergenic
957921420 3:86753362-86753384 GTCTTGTTCCAGTTCTCAGGCGG + Intergenic
958432528 3:94059455-94059477 CTGTGGTCCCAGCACTTTGGGGG - Exonic
958581252 3:96026672-96026694 CTGTGATCCCAGTACTTGGGAGG - Intergenic
958775079 3:98472467-98472489 CTGTGGTTTCAATTCCCAGGGGG - Intergenic
958884047 3:99706210-99706232 CTATTTTTCCAGTACTGAGGAGG - Intronic
958892625 3:99797392-99797414 CAGTAGTCCCAGTACTCGGGAGG - Exonic
959072251 3:101713763-101713785 CTGTAATCCCACTACTCAGGAGG - Intergenic
959151420 3:102612565-102612587 CTTTGTTTCCAGTAATCAGTGGG - Intergenic
959721972 3:109501924-109501946 GTCTTGTTCCAGTTCTCAGGTGG + Intergenic
959745392 3:109770432-109770454 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
960152706 3:114266875-114266897 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
960163520 3:114376324-114376346 CTGTGATGCCAGCACTCAAGGGG + Intronic
960379566 3:116943283-116943305 GTGTTGTTCCAGTTCTCAGGGGG - Intronic
960558243 3:119053068-119053090 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
960643497 3:119852468-119852490 CTGTAATCCCACTACTCAGGAGG - Intronic
960678940 3:120226885-120226907 ATGTAATCCCAGTACTCAGGAGG - Intronic
960732271 3:120740381-120740403 CTGTAGTCCCGCTACTCAGGAGG - Intronic
961184122 3:124899730-124899752 CTGTGGTCCCACCACTCAGGAGG + Intronic
961304252 3:125945301-125945323 CTGTAGTCCCAGCACTCAAGAGG - Intergenic
961561165 3:127731273-127731295 CTGTAGTCCCAGTACTTGGGAGG - Intronic
961562525 3:127740572-127740594 CTGAGGTTCCAGTTCTGTGGGGG + Intronic
961684642 3:128621252-128621274 CTGTAATTCCAGTACTTTGGAGG + Intronic
962016758 3:131448762-131448784 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
962323686 3:134414008-134414030 CTATAATCCCAGTACTCAGGAGG + Intergenic
962861865 3:139410780-139410802 ATCTTGTTCCAGTTCTCAGGGGG + Intergenic
963014191 3:140805297-140805319 ATCTTGTTCCAGTTCTCAGGGGG + Intergenic
963014805 3:140812110-140812132 CTGTAGTCCCAGTACTTTGGGGG + Intergenic
963383891 3:144566554-144566576 ATCTTGTTCCAGTTCTCAGGGGG - Intergenic
963687927 3:148461376-148461398 ATGTTGTTCCAGTCCTCAGAAGG - Intergenic
963743695 3:149104895-149104917 CTGTAATTCCAGTACTTGGGAGG - Intergenic
963804423 3:149709095-149709117 CCATAGTCCCAGTACTCAGGAGG - Intronic
963917401 3:150871589-150871611 CTATGGTCCCAGTACTTTGGGGG + Intronic
964355830 3:155851117-155851139 CTGTAATCCCACTACTCAGGAGG + Intronic
964393942 3:156225493-156225515 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
964772999 3:160244241-160244263 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
964991194 3:162814683-162814705 GTGTTGTTCCAGTTCTCAAGGGG + Intergenic
965228236 3:166019412-166019434 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
965378379 3:167955943-167955965 CTCTTGTTCCAGTTCTCAGAGGG + Intergenic
965788463 3:172361796-172361818 CTGTGGTCCCAGTACTTGGGAGG - Intronic
965801839 3:172502482-172502504 CTGTGTTCCCATGACTCAGGAGG - Intergenic
965807660 3:172558731-172558753 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
966418560 3:179714990-179715012 CTGTGCTCCCAGTACTTGGGAGG - Intronic
966447222 3:180015186-180015208 GTGTGGTTCCTGTCCTCAAGGGG - Intronic
966998908 3:185313065-185313087 CTGTAGTTTCAGCTCTCAGGAGG + Intronic
967019597 3:185511152-185511174 CTGTAATCCCACTACTCAGGAGG - Intronic
967151741 3:186657575-186657597 CTGTAGTCCCAGTACTCAGGAGG + Intergenic
967202367 3:187083380-187083402 CTGTGGTCCCGATACTTAGGAGG + Intergenic
967203619 3:187098938-187098960 GTCTTGCTCCAGTACTCAGGGGG - Intergenic
967862156 3:194160375-194160397 CTGTGGTTTCAGTCCTCAGCGGG - Intergenic
968191678 3:196672796-196672818 CTGTAATCCCAGTACCCAGGAGG - Intronic
968624395 4:1620083-1620105 CTGTAGTCCCAGTACTGGGGAGG + Intronic
968678891 4:1902344-1902366 CTGTGGTCCAACTACTCAGGAGG - Intronic
968771123 4:2507974-2507996 CTGTAGTCCCAGTACTCCTGGGG - Intronic
969480575 4:7444974-7444996 CTGTGGTTGCAACACCCAGGTGG + Intronic
969588081 4:8106171-8106193 GTGTGGCTACAGTGCTCAGGTGG + Intronic
969965941 4:10995420-10995442 CTGTAGTCCCGGTACTCGGGAGG + Intergenic
970301381 4:14684784-14684806 CTGTAATCCCAGTACTCAGGAGG - Intergenic
970388104 4:15577113-15577135 CTGTGGTCCCAGTACTTGGGAGG - Intronic
970544204 4:17110393-17110415 CTGTAATCCCAGTACCCAGGAGG - Intergenic
970653906 4:18209703-18209725 GTCTGGTTCCAGTTCTCAAGGGG + Intergenic
971080770 4:23208270-23208292 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
971237893 4:24859519-24859541 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
971288587 4:25313616-25313638 CTGTAGTTCCAGCACTTGGGGGG + Intronic
971335857 4:25723627-25723649 CAATGGTTCCTGTACTCATGAGG + Intergenic
971364889 4:25969808-25969830 CTGAGGGTCCAGTCCTTAGGCGG - Intergenic
971434326 4:26604273-26604295 CTGTAGTCCCAGTACTCGGGAGG - Intronic
971740961 4:30520598-30520620 CTGTAGTTCCAGCCCTGAGGTGG + Intergenic
971762869 4:30790799-30790821 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
971815627 4:31484316-31484338 CTGTAATCCCAGCACTCAGGAGG + Intergenic
972515345 4:39805995-39806017 CTGTAGTTCAACTACTCTGGAGG + Intergenic
972521799 4:39865430-39865452 CTATAGTCCCACTACTCAGGAGG + Intronic
972540779 4:40037518-40037540 CTGTAATCCCACTACTCAGGAGG + Intergenic
972571899 4:40318662-40318684 CTGTGGTCCCAGCTCTCTGGAGG + Intergenic
972661622 4:41122045-41122067 CTGTAGTTCCACTACTTAGGAGG - Intronic
972665656 4:41162731-41162753 CTGCGGTCCCAGCACTCAGGAGG + Intronic
972838391 4:42903044-42903066 CTGGGCTTCTAGAACTCAGGAGG + Intronic
974127429 4:57713772-57713794 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
974498928 4:62672317-62672339 CTGTAATTCCAGCACTCGGGAGG - Intergenic
974656656 4:64832648-64832670 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
974667301 4:64980607-64980629 CTGTGGTTCTAGTACTTGGGAGG - Intergenic
975099493 4:70496592-70496614 CTGTGGTCCAGCTACTCAGGAGG - Intergenic
975536685 4:75458833-75458855 CTGTAATCCCAGTATTCAGGAGG - Intergenic
975670669 4:76777664-76777686 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
975837156 4:78435614-78435636 CTATAATCCCAGTACTCAGGAGG + Intronic
975899515 4:79135068-79135090 TTTTTGTTCCAGTTCTCAGGGGG + Intergenic
976271032 4:83230399-83230421 CTGTTGTTCCAGCACTTTGGGGG + Intergenic
976727317 4:88227272-88227294 CTGTAATTCCAGTACTAGGGAGG + Intronic
976788569 4:88851127-88851149 CTCTGGTTGCAGTACTCTGTGGG + Exonic
977199279 4:94096764-94096786 CTGTGGTCCCAGGCCCCAGGAGG - Intergenic
977251019 4:94688919-94688941 CTGTAATCCCACTACTCAGGGGG + Intergenic
977474254 4:97485129-97485151 CTCTTGTTCCAGTTCTCAGAGGG - Intronic
977906909 4:102487510-102487532 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
977929978 4:102739865-102739887 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
977975773 4:103264920-103264942 GTGTTGTTCCAGTTCTCAGGGGG + Intergenic
979515797 4:121608591-121608613 ATGTGGTTCCAGCACTGTGGAGG - Intergenic
979691855 4:123567828-123567850 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
979712323 4:123794414-123794436 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
980019675 4:127693641-127693663 GTCTTGTTCCAGTTCTCAGGAGG + Intronic
980115795 4:128677994-128678016 CTGTAGTTCAGCTACTCAGGAGG + Intergenic
980984675 4:139684045-139684067 CTGTAGTCCCAGTACGCAGGAGG - Intronic
981177392 4:141697905-141697927 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
981335734 4:143567203-143567225 GTCTTGTTCCAGTTCTCAGGCGG + Intergenic
981925889 4:150138786-150138808 CTGTAGTCCCGCTACTCAGGAGG - Intronic
982520041 4:156405085-156405107 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
982693992 4:158579388-158579410 CTGTAGTTCCTGTACTCAGGAGG - Intronic
982775553 4:159437994-159438016 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
982855222 4:160373776-160373798 CTGTGGTGGCAGTACTCTGTAGG + Intergenic
983001891 4:162425226-162425248 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
983710743 4:170712777-170712799 CTGTAGTCCCAGTACTCGGGAGG + Intergenic
983729570 4:170976550-170976572 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
983764309 4:171458254-171458276 CTGTAGTCCCAGTACTCAGGAGG + Intergenic
984002564 4:174268556-174268578 CTGTAGTCCCAGCACTCTGGAGG - Intronic
984236256 4:177162357-177162379 GTGTTGTTCCAGTTCTCAAGGGG - Intergenic
984527224 4:180871860-180871882 GTGTTGTTCCAGTTCTCAGAGGG + Intergenic
984827526 4:183940023-183940045 CTGTAATTCCAGTACTCAGGAGG - Intronic
984871282 4:184327403-184327425 ATGTAGTCCCAGTACTCAGGAGG + Intergenic
985261263 4:188117127-188117149 CTGTGATCCCAGTACTTTGGCGG - Intergenic
985398035 4:189565559-189565581 CTGTGCTTCCAGTAATCACAGGG - Intergenic
985681059 5:1256130-1256152 CTGTAGTTCCAATACTTGGGAGG - Intronic
986487820 5:8257757-8257779 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
986859100 5:11904841-11904863 CTGTGATTCCAGAGCTAAGGAGG + Intergenic
987176504 5:15316177-15316199 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
987607604 5:20157762-20157784 CTGTAGTCCCGCTACTCAGGAGG - Intronic
987902186 5:24027033-24027055 GTCTAGTTCCAGTTCTCAGGTGG - Intronic
988112683 5:26843369-26843391 CTATAGTCCCAGCACTCAGGAGG + Intergenic
988325796 5:29765770-29765792 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
988471134 5:31539927-31539949 CTGTGGTCCAGCTACTCAGGAGG + Intronic
989025037 5:37058041-37058063 CTGTAATTCCAGCCCTCAGGAGG - Intronic
989037584 5:37191710-37191732 CTGTAGTCCCAGTACTCAAGGGG + Intronic
989087055 5:37686613-37686635 CTGTAGTCCCAGTACTTGGGAGG + Intronic
989316817 5:40090715-40090737 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
989323356 5:40162310-40162332 CTGTAATCCCAGTACTCGGGAGG - Intergenic
989355123 5:40535414-40535436 GTTTTGTTCCAGTTCTCAGGGGG + Intergenic
989431323 5:41358785-41358807 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
989733594 5:44676352-44676374 CTGTAGTTCCAGCACTTGGGGGG + Intergenic
989764925 5:45071042-45071064 CTGTAATTCCAGTACTCGGGAGG + Intergenic
990399541 5:55424266-55424288 CTGTAGTTCAGCTACTCAGGAGG - Intronic
990602436 5:57373216-57373238 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
990920203 5:60956021-60956043 CTGTAGTCCCAGTACTTAGGAGG - Intronic
991377890 5:65985213-65985235 CTGTAATCCCAGTACTCAAGAGG - Intronic
991402216 5:66263198-66263220 CTGTAATTCCAGTACTTGGGAGG + Intergenic
991406269 5:66303694-66303716 CTGTAGTCCCAGTACTCGGGAGG - Intergenic
991617989 5:68517052-68517074 CTGTAATCCCCGTACTCAGGAGG - Intergenic
991906198 5:71513839-71513861 CTGTAGTCCCAGCATTCAGGAGG - Intronic
991916565 5:71611278-71611300 CTATGGTTCCAGCTTTCAGGAGG + Intronic
992042835 5:72853317-72853339 CTGTGGTCCCGCTACTCAGGAGG + Intronic
992133912 5:73723308-73723330 CTGTAGTCCCAGTACTCAGGAGG - Intronic
992252053 5:74885665-74885687 CTGTAGTCCCAGCATTCAGGAGG + Intergenic
992403757 5:76436285-76436307 GTCTTGTTCCAGTACTCAGGGGG + Intronic
992617456 5:78558596-78558618 CTGTAATCCCAGTATTCAGGAGG - Intronic
992732318 5:79684376-79684398 CTATAGTCCCAGCACTCAGGAGG - Intronic
993283064 5:85952557-85952579 CTGTAGTCCCACTACTCGGGAGG - Intergenic
993448084 5:88039548-88039570 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
993608632 5:90027253-90027275 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
993610422 5:90046704-90046726 CTGTAATTCCAGCTCTCAGGAGG + Intergenic
993698869 5:91094716-91094738 TGGTGATACCAGTACTCAGGAGG + Intronic
993708775 5:91201213-91201235 CTGTGATTCTGCTACTCAGGAGG + Intergenic
993796952 5:92279497-92279519 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
994347608 5:98705524-98705546 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
994358284 5:98820390-98820412 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
994449292 5:99920701-99920723 CTGTGGTCCCAGTACTTGGAAGG + Intergenic
994569886 5:101502693-101502715 CTGTAATCACAGTACTCAGGAGG + Intergenic
994591380 5:101777556-101777578 GTGTTGTTCCAGTTCTCAAGGGG - Intergenic
994628419 5:102250863-102250885 CTGTAGTCCCAGTTCTCGGGAGG + Intronic
994940957 5:106323643-106323665 CTGTAATCCCAGTACTCAAGAGG + Intergenic
996311625 5:122112824-122112846 CTGTGGTTCCAGTACCAGAGAGG + Intergenic
996779888 5:127173572-127173594 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
996799298 5:127385393-127385415 CTGTAATCCCAGCACTCAGGAGG - Intronic
996875069 5:128231671-128231693 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
997119757 5:131162199-131162221 CTGTTGTCCCACTACTCGGGAGG + Intronic
997489398 5:134260659-134260681 CCGTAGTCCCACTACTCAGGAGG - Intergenic
997627839 5:135342993-135343015 CTGTGGTCCCAGTACACACTGGG + Intronic
997708422 5:135981220-135981242 CTTTAGTTCCAGCACTCAGGAGG - Intergenic
997798016 5:136830557-136830579 GTGTTGTTCCAGTTCTCAGGAGG + Intergenic
998105395 5:139465725-139465747 CTATAGTCCCAGCACTCAGGAGG + Intergenic
998139692 5:139692939-139692961 CTGGGGGTCCAAGACTCAGGAGG + Intergenic
998243969 5:140479118-140479140 CTGTAGTCCCATTACTCAGGAGG - Intronic
998258031 5:140604270-140604292 CTGTAGTAACAGCACTCAGGAGG + Intergenic
998741964 5:145213960-145213982 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
998966028 5:147540975-147540997 CTGTAGTCCCAGTACTGGGGAGG - Intergenic
999254585 5:150202950-150202972 CTGTAATCCCAGTACTCAGGAGG + Intronic
999350746 5:150869052-150869074 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
999441920 5:151608202-151608224 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
999620025 5:153463449-153463471 CTGTAGTCCCACTACTCAGGAGG - Intergenic
999699503 5:154215358-154215380 CTGTAGTCCCAGTACTTGGGAGG + Intronic
999797497 5:155002096-155002118 CTGTAGTCCCAGTACTCAGGCGG + Intergenic
999839246 5:155406919-155406941 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
999999824 5:157127132-157127154 CTGTAGTCCCACTACTCAGGAGG + Intronic
1000959528 5:167583696-167583718 CTGTGTTTCCTGTCCTCAAGGGG + Intronic
1000959767 5:167586000-167586022 CTGTAGTCCCAGTACTCGGGAGG + Intronic
1001012956 5:168115169-168115191 CTGTAGTCCCGCTACTCAGGAGG + Intronic
1001053015 5:168427836-168427858 CTGTAGTTCCAGTATTTGGGAGG + Intronic
1001356828 5:171034942-171034964 CTATGGTCCCAGTTCTCAGGAGG - Intronic
1001491330 5:172157711-172157733 CTGTAGTTCCAGTTCTCGGGAGG - Intronic
1001665650 5:173431693-173431715 CTGTGATTCCAGCACTTGGGAGG + Intergenic
1001733920 5:173982791-173982813 CTATGGTCCCACTACACAGGAGG + Intronic
1002152798 5:177249607-177249629 CTATAGTCCCGGTACTCAGGAGG - Intronic
1002994393 6:2269194-2269216 CTGTGGCCCCACTACTCAGGAGG + Intergenic
1003033067 6:2619517-2619539 CTGTGGTTCCATTACTTCTGTGG - Intergenic
1003391595 6:5718034-5718056 CTGTAATCCCATTACTCAGGAGG - Intronic
1003517954 6:6833491-6833513 CTGTAGTCCCGCTACTCAGGAGG + Intergenic
1003585254 6:7382786-7382808 CTGTAGTTTCATTACTCAGGAGG + Intronic
1003602770 6:7533148-7533170 CTGTAGTTCCAGCACTTCGGTGG + Intergenic
1003714714 6:8633515-8633537 CTGTGACTCCAGTCCTTAGGAGG + Intergenic
1003902122 6:10664053-10664075 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
1004096884 6:12564620-12564642 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1004333742 6:14744862-14744884 CTGTAGTCCCAGTACGGAGGAGG + Intergenic
1004404193 6:15316757-15316779 CTGTAATCCCAGCACTCAGGAGG - Intronic
1004774255 6:18824690-18824712 CTGTGATCCAGGTACTCAGGAGG - Intergenic
1004888871 6:20078487-20078509 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1004922683 6:20391447-20391469 CTGTGGTCCAGCTACTCAGGAGG - Intergenic
1004973933 6:20943837-20943859 CTGTTGTCCCAGTACTCAGAAGG + Intronic
1005214816 6:23513030-23513052 CTGCAGTCCCAGCACTCAGGAGG + Intergenic
1005292233 6:24391029-24391051 CTGTAATCCCGGTACTCAGGAGG + Intergenic
1005587016 6:27286873-27286895 CTGTAATCCCAGTACTCAGGAGG + Intronic
1005652401 6:27896269-27896291 CTGTAGTTCAGCTACTCAGGAGG - Intergenic
1005771064 6:29072067-29072089 CTGAGGATTCAGTCCTCAGGGGG - Intronic
1005891804 6:30146531-30146553 CTGTAGTCCCAGTACTCGGGAGG - Intronic
1005925695 6:30443826-30443848 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1006124877 6:31831102-31831124 CTGTAGACCCAGTACTCAGGAGG - Intergenic
1006286576 6:33100526-33100548 ATCTTGTTCCAGTTCTCAGGGGG - Intergenic
1006649495 6:35539095-35539117 TTGTAGTCCCAGTACTCAAGAGG - Intergenic
1006758460 6:36438543-36438565 CTGTAGTCCCGGTACTCGGGAGG - Intronic
1006778874 6:36618237-36618259 CTGTAGTCCCAGTACTCGGGAGG + Intergenic
1007134792 6:39510213-39510235 CTGTAGACCCAGTACTCGGGAGG - Intronic
1007361811 6:41362721-41362743 CTGTAATCCCAGTACTCAGAAGG + Intergenic
1007591351 6:43022752-43022774 CTGTAGTCCCACTACTCGGGAGG - Intronic
1007668715 6:43533711-43533733 CTGTGGTCCAACTACTCGGGAGG + Intronic
1007837788 6:44688424-44688446 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1008073165 6:47118042-47118064 CTGTAGTCCCAGTACTCGGGAGG + Intergenic
1008120968 6:47616349-47616371 CTGTAATCCCAGTACTCTGGAGG - Intronic
1008144890 6:47879246-47879268 CTGCTGTTCCAGTACTCTAGGGG + Exonic
1009208764 6:60836524-60836546 CTTTTGTTCCAGTTTTCAGGGGG - Intergenic
1009243729 6:61207955-61207977 CTGCAGTTCCACTACTCAGGAGG - Intergenic
1009381430 6:63035389-63035411 CTGTAATCCCATTACTCAGGAGG - Intergenic
1009780984 6:68269828-68269850 CTCTTATTCCAGTTCTCAGGGGG + Intergenic
1009867415 6:69414500-69414522 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1010027998 6:71241864-71241886 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1010207265 6:73334217-73334239 CTGTAGCCCCAGTACTCAGGAGG + Intergenic
1010340172 6:74740967-74740989 CTGTAATCCCACTACTCAGGAGG + Intergenic
1010479551 6:76334443-76334465 GTCTCGTTCCAGTTCTCAGGTGG + Intergenic
1010518052 6:76798902-76798924 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1010654763 6:78499216-78499238 GTGTTGTTCCAGTTCTCAGGGGG + Intergenic
1010825153 6:80464247-80464269 CTGTGGTCCCAGTACTCAGGAGG - Intergenic
1011365723 6:86579954-86579976 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1011670987 6:89682823-89682845 CTGTGGTCCCAGCACTCAGGAGG + Intronic
1012068850 6:94585780-94585802 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1012302674 6:97608886-97608908 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1012552153 6:100473332-100473354 CAGTGGTGCCAGTACTCATTGGG - Intergenic
1012758113 6:103259370-103259392 CTGTAGTCCAAGTACTCCGGAGG - Intergenic
1013222719 6:108093584-108093606 CTGTAATTCCGCTACTCAGGAGG + Intronic
1013238548 6:108221666-108221688 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1013508529 6:110822991-110823013 CTGTAATCCCAGTACTCAGGAGG + Intronic
1013786128 6:113783247-113783269 CTGTAGTCTCACTACTCAGGAGG + Intergenic
1013857027 6:114585269-114585291 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1014275986 6:119389517-119389539 CCGTAGTCCCAGGACTCAGGAGG + Intergenic
1014401646 6:120997191-120997213 CTGTAGTCCCAGTACTTGGGAGG + Intergenic
1014532351 6:122573844-122573866 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1014602021 6:123425014-123425036 CTATGGTACCAGAACTGAGGTGG + Intronic
1014655923 6:124103962-124103984 CTATAGTCCCAGTACTCAGGAGG + Intronic
1014742890 6:125167140-125167162 CTGTAGTCCCACTACTCAAGAGG + Intronic
1014852430 6:126358274-126358296 GTCTGGTTCCAGTTCTCAAGAGG + Intergenic
1014936692 6:127394112-127394134 CTGTGGTCCCACTACTCGGGAGG - Intergenic
1015048637 6:128811454-128811476 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1015195583 6:130521739-130521761 CTGTAGTCCCAGTACTGGGGAGG + Intergenic
1015289010 6:131517102-131517124 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1015348179 6:132184183-132184205 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1015643948 6:135365878-135365900 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1015645023 6:135377600-135377622 CTGTAGTCCCACTACTCGGGTGG - Intronic
1015735371 6:136393895-136393917 CTGTAATCCCAGCACTCAGGGGG - Intronic
1015879226 6:137854504-137854526 CTGTAGTACCAGTACTTGGGAGG + Intergenic
1016176520 6:141083043-141083065 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1016449198 6:144163822-144163844 TTGTAGTCCCAGTACCCAGGAGG + Intronic
1016484719 6:144524758-144524780 TTCTTGTTCCAGTTCTCAGGGGG + Intronic
1017505821 6:155067762-155067784 CTGTAGTCCCAGTACTTGGGAGG - Intronic
1017648337 6:156559153-156559175 CTGTAGTCCTAGTACTCACGAGG + Intergenic
1017825276 6:158077115-158077137 CTGTAATCCCAGCACTCAGGAGG - Intronic
1017840317 6:158216850-158216872 CTGTAATCCCAGTACTCGGGAGG - Intergenic
1017841391 6:158225526-158225548 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1018244715 6:161811798-161811820 CTGTAGTCCCGCTACTCAGGAGG + Intronic
1018353289 6:162985628-162985650 GTCTTGTTCCAGTTCTCAGGAGG - Intronic
1018454985 6:163943822-163943844 CTGTGGTCCCAGTTCTATGGGGG + Intergenic
1018508763 6:164501831-164501853 CTCTAGTCCCAGTTCTCAGGAGG + Intergenic
1018656127 6:166038078-166038100 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1018800143 6:167215751-167215773 CTGTAGTCCCACTACTCAAGAGG - Intergenic
1019385830 7:755607-755629 CTGTGGTTCCAGCTCCCGGGAGG + Intronic
1019401795 7:858895-858917 CTGTGATTCCAGCACTCTGGAGG + Intronic
1019540845 7:1550347-1550369 CTGTGTTTCCAGTACCTGGGAGG - Exonic
1019541228 7:1552098-1552120 CTGTAGTCCCAATACTCAGCAGG - Intronic
1019970307 7:4535398-4535420 CTGTAATTCCAGTATTGAGGTGG + Intergenic
1020049290 7:5071481-5071503 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1020064673 7:5178173-5178195 CTGTGGTCCCAGCTCTCGGGAGG + Intergenic
1020128353 7:5545652-5545674 TTGTGGTTCCAGCACACAGCAGG + Intronic
1020195963 7:6039497-6039519 CTGTAATCCCACTACTCAGGAGG + Intronic
1020455534 7:8369905-8369927 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1020813755 7:12878439-12878461 CTGTAATCCCAGTACTCGGGAGG + Intergenic
1021115558 7:16742681-16742703 CTGTAGTTCCACTACTCAAGAGG + Intergenic
1021183600 7:17536929-17536951 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1021223454 7:18000790-18000812 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
1021254578 7:18375345-18375367 TTGTAATCCCAGTACTCAGGAGG + Intronic
1021388044 7:20056460-20056482 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1021458396 7:20857087-20857109 CTGTAGTCCCACTGCTCAGGAGG - Intergenic
1021942348 7:25690092-25690114 CTCTGGATCAGGTACTCAGGAGG + Intergenic
1022031604 7:26496636-26496658 CTGTGGTCCCACTACTCGGGAGG - Intergenic
1022043893 7:26607841-26607863 TTGTAGTTCCAGTGATCAGGAGG - Intergenic
1022469453 7:30673329-30673351 CTGTAGTCCCATTACTCAGGAGG - Intronic
1022773684 7:33502030-33502052 CTGTAATCCCAGTACTCGGGAGG - Intronic
1022971220 7:35519143-35519165 CTGGGGTGACAGAACTCAGGTGG - Intergenic
1023385558 7:39653445-39653467 CTGTGGTCTCAGTTCTCAGAAGG - Intronic
1023721786 7:43103298-43103320 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1023906674 7:44527333-44527355 CTGTAATCCCAGTACTCGGGGGG + Intronic
1023941794 7:44773121-44773143 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1023941799 7:44773151-44773173 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1023941804 7:44773181-44773203 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1024326546 7:48113832-48113854 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1024650374 7:51398366-51398388 CTGTAATTCCAGCACTCTGGGGG - Intergenic
1024847507 7:53664657-53664679 TTTTGGTTCCAGTTCTCAAGGGG + Intergenic
1024863358 7:53873003-53873025 ATCTTGTTCCAGTTCTCAGGAGG - Intergenic
1024929682 7:54656992-54657014 CTGTAGTCCTAGTGCTCAGGAGG + Intergenic
1024946778 7:54816068-54816090 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1024968737 7:55049657-55049679 CTGTGCTGGCAGTCCTCAGGTGG - Intronic
1025212919 7:57031221-57031243 CTGTAATTCCACTACTCATGAGG + Intergenic
1025659034 7:63545603-63545625 CTGTAATTCCACTACTCATGAGG - Intergenic
1025733195 7:64124550-64124572 CTGTGGTCCAGCTACTCAGGAGG + Intronic
1025998324 7:66542522-66542544 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1026071041 7:67119907-67119929 CTGTGGTCCCAGTACTTGGAAGG - Intronic
1026195625 7:68170949-68170971 CTGTGGTCCCAGTACTGGGGAGG + Intergenic
1026322089 7:69277043-69277065 CTGTAGTTCCATGACTCGGGAGG - Intergenic
1026470218 7:70688700-70688722 CCATAGTCCCAGTACTCAGGAGG + Intronic
1026545022 7:71314782-71314804 CTGTAGTCCCATTACTCTGGAGG + Intronic
1026584745 7:71647184-71647206 CTGTAATCCCAGTACTTAGGAGG - Intronic
1026705859 7:72692390-72692412 CTGTGGTCCCAGTACTTGGGAGG + Intronic
1026795357 7:73362980-73363002 CTGTTGTCCCACTACTCGGGGGG + Intergenic
1026912867 7:74101944-74101966 CTGTAGTCTCACTACTCAGGAGG - Intronic
1026938280 7:74271553-74271575 CTGTCATCCCAGTACTTAGGGGG - Intergenic
1026991276 7:74587320-74587342 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1027151109 7:75734322-75734344 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1027165186 7:75829153-75829175 CTGTAGTCCCGCTACTCAGGAGG + Intergenic
1027165953 7:75834582-75834604 CTGTAGTCCCGCTACTCAGGAGG - Intergenic
1027380480 7:77604008-77604030 CTGTAATCCCAGTACTCGGGAGG - Intronic
1027562868 7:79754090-79754112 GTCTTGTTCCAGTACTCAGGAGG + Intergenic
1027577973 7:79954890-79954912 CTGTAGTCCCAGTACTCGGAAGG + Intergenic
1027631152 7:80607891-80607913 CTGTAGTCCCAGCACTCGGGAGG - Intronic
1027732926 7:81898909-81898931 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1027774667 7:82448893-82448915 CTGTAGTCCCAGTACTCTGGAGG + Intergenic
1027970371 7:85072810-85072832 CTGTAATGCCAATACTCAGGAGG - Intronic
1028502202 7:91531561-91531583 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1028556040 7:92125871-92125893 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1028826670 7:95281488-95281510 CTGTGCATCCAGCACTGAGGAGG - Intronic
1028965793 7:96799584-96799606 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1028996041 7:97101220-97101242 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1029157987 7:98530871-98530893 CTGTAATCCCAGTACTCGGGAGG - Intergenic
1029246631 7:99206725-99206747 CTGTGTTCCCAGTACTTTGGGGG - Intronic
1029262498 7:99312737-99312759 CTGTGATTCCAGAACTTTGGGGG + Intergenic
1029463553 7:100710898-100710920 CTGTGGTCCAGCTACTCAGGAGG + Intergenic
1029508766 7:100979907-100979929 CTGTAGCCCCAGTACTCAGGAGG + Intronic
1029690812 7:102180143-102180165 CTGTAGTTCAGTTACTCAGGAGG - Intronic
1029746886 7:102520659-102520681 CTGTAGTCCCACTACTCGGGAGG + Intergenic
1029764839 7:102619748-102619770 CTGTAGTCCCACTACTCGGGAGG + Intronic
1030255301 7:107504065-107504087 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1030307224 7:108031199-108031221 CTGTAGTCCCAGTACTCGGGAGG + Intronic
1030584311 7:111398547-111398569 GTCTTGTTCCAGTACTCAGAAGG - Intronic
1030699088 7:112619128-112619150 CTGTAATTCCACTACTCAGGAGG + Intergenic
1031058954 7:117027316-117027338 CTGTAGTCCCAGCACTGAGGAGG + Intronic
1031085378 7:117297299-117297321 CTGTGGTCCAGCTACTCAGGAGG - Intronic
1031090137 7:117344741-117344763 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1031220064 7:118953923-118953945 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1031389782 7:121200017-121200039 CTGTGTTTCAAGTGCTCAGTAGG + Intronic
1031736219 7:125365303-125365325 CTGTAATCCCAGTACCCAGGAGG - Intergenic
1031796560 7:126182594-126182616 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1032234523 7:130108595-130108617 CTGTGGTCCCAGCACTCATCAGG + Intronic
1032419044 7:131762939-131762961 CTGTGGCTCCAGCCATCAGGAGG - Intergenic
1032604958 7:133340078-133340100 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1032936006 7:136732390-136732412 GTTTTGTTCCAGTTCTCAGGGGG - Intergenic
1033027152 7:137786044-137786066 GTTTTGTTCCAGTTCTCAGGGGG - Intronic
1034036322 7:147827050-147827072 CTGTAGTCCCGCTACTCAGGAGG - Intronic
1034475444 7:151278999-151279021 CTGTAGTCCCACTACTTAGGAGG - Intergenic
1034495410 7:151418033-151418055 CTGTAGTCCCCGTACTCAGGAGG + Intergenic
1034627632 7:152505631-152505653 CTGTAATTCCAGTACTTTGGGGG - Intergenic
1034654655 7:152719921-152719943 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1034661847 7:152777826-152777848 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1035063506 7:156088362-156088384 CTCTGGTTCCAGCACACTGGTGG + Intergenic
1035482590 7:159199233-159199255 CTATAGTCCCAGTACACAGGAGG - Intergenic
1035840559 8:2808393-2808415 TGGTGGCTCCAGTGCTCAGGTGG - Intergenic
1037300798 8:17450026-17450048 CTGTAATCCCAGTACTCGGGAGG - Intergenic
1037809577 8:22079511-22079533 CTGTAGCTCCAGTACTTGGGAGG + Intronic
1037824421 8:22152617-22152639 CTGTGGTCCCAGCACTTGGGAGG + Intronic
1037864968 8:22436209-22436231 CTGTAGTCCCAGTACTTTGGGGG + Intergenic
1037872787 8:22514800-22514822 CTGTAATCCCAGTACTCAGGAGG - Intronic
1037896652 8:22661004-22661026 CTGTAGTCCCAGCACTCAGCAGG - Intronic
1038161390 8:25042426-25042448 CTGTAGTCCCACTACTCAGAAGG + Intergenic
1038537780 8:28366447-28366469 CTATAGTTCCACTACTCAGGAGG + Intronic
1038561533 8:28585315-28585337 CTGTGGTTCCAGTTATCAGGAGG - Intergenic
1038656463 8:29457018-29457040 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1038751616 8:30301353-30301375 CTGTAGTCCCAGTACTCTGGAGG - Intergenic
1038837253 8:31140147-31140169 CTGTTGTTCCGCTACTCAGGAGG - Intronic
1039295116 8:36142378-36142400 CTGTAGTCCTAGTACTCAGGAGG + Intergenic
1039653472 8:39371637-39371659 ATCTTGTTCCAGTTCTCAGGGGG - Intergenic
1040505741 8:48046239-48046261 CTGTAGTCCCACTACTCGGGAGG - Intronic
1040670781 8:49687767-49687789 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1040867701 8:52066663-52066685 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1040941603 8:52839698-52839720 CTGTAGTCCCAGTACTCGGGAGG + Intergenic
1040966936 8:53092168-53092190 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1041099921 8:54385857-54385879 CTATAATCCCAGTACTCAGGAGG - Intergenic
1041199329 8:55435689-55435711 CTGGGGTCCCACTATTCAGGAGG - Intronic
1041284791 8:56249210-56249232 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1041560369 8:59210921-59210943 GTTTTGTTCCAGTTCTCAGGGGG + Intergenic
1042034727 8:64519631-64519653 CTGTGAGTGCAGTAATCAGGTGG + Intergenic
1042181923 8:66098323-66098345 CTGTGGTCCCAGTATTCAGGAGG - Intronic
1042269672 8:66942245-66942267 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1042281043 8:67056312-67056334 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1042464420 8:69110923-69110945 CTGTGGTCCCCCTACTCAGCAGG + Intergenic
1042609176 8:70578229-70578251 CTGTAGTCCCAGTACTTGGGAGG - Intronic
1042897162 8:73683532-73683554 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1042902390 8:73742406-73742428 CTGTAGTCCAGGTACTCAGGAGG + Intronic
1042905488 8:73767829-73767851 CTGTAGTTCAGCTACTCAGGAGG + Intronic
1043537441 8:81221589-81221611 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1043665678 8:82809602-82809624 CTGTTTTCCCAGTACTCAGATGG + Intergenic
1043876054 8:85487614-85487636 GTCTTGTTCCAGTTCTCAGGTGG + Intergenic
1044036058 8:87304834-87304856 CTCTTGTTCCAGTTCTCAGAAGG - Intronic
1044139717 8:88635335-88635357 CTGTAGTCCTATTACTCAGGAGG + Intergenic
1044572058 8:93731036-93731058 CTGTAGTCCCAGCTCTCAGGAGG + Exonic
1044903646 8:96975911-96975933 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1044971956 8:97628494-97628516 CTGTGGTCCCAGCTATCAGGAGG + Intergenic
1045463903 8:102451559-102451581 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1045935854 8:107677992-107678014 CTGTAGTCCCACTACTCGGGAGG + Intergenic
1046622430 8:116542636-116542658 CTGTAGTCCTACTACTCAGGAGG - Intergenic
1046955011 8:120053860-120053882 CTGCAGTCCCACTACTCAGGAGG - Intergenic
1046985867 8:120387931-120387953 GTTTTGTTCCAGTTCTCAGGGGG + Intronic
1047155054 8:122307647-122307669 CTGTAATTCCAGCACTCTGGAGG + Intergenic
1047614304 8:126550583-126550605 CTGTGATCCCAGCACTCAGGAGG - Intergenic
1047681167 8:127255782-127255804 CAGTAGTCCCAGAACTCAGGAGG - Intergenic
1047874978 8:129126149-129126171 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1048189979 8:132279094-132279116 CTGTAATCCCACTACTCAGGAGG + Intronic
1048371372 8:133780118-133780140 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1048658214 8:136567187-136567209 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1048825465 8:138420916-138420938 GTGTGGTTCCAGTGCTCAAGGGG - Intronic
1048871282 8:138801477-138801499 CTGTGTTCTCAGTGCTCAGGAGG - Intronic
1049076797 8:140403305-140403327 CTGTAGTCCCGCTACTCAGGAGG + Intronic
1050104719 9:2153408-2153430 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1050133313 9:2435746-2435768 GTCTGGTTCCAGTTCTCAGGGGG + Intergenic
1050488053 9:6155891-6155913 CTGTGGTCTCAGTACTCAGGGGG + Intergenic
1050513686 9:6420176-6420198 CTGTAATCCCACTACTCAGGAGG - Intronic
1050917028 9:11149182-11149204 CTGTAATCCCAGTACTCGGGAGG + Intergenic
1051101273 9:13524652-13524674 CTGTAGACCCAGTACTCAGGAGG + Intergenic
1051105507 9:13574925-13574947 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1051163000 9:14229921-14229943 CTGTAATTCCACTACTCGGGAGG - Intronic
1051297809 9:15615898-15615920 CTGTGGTCCCAGTACTTGGAGGG - Intronic
1051546765 9:18284105-18284127 CTGTAATTCCACTACTCGGGAGG + Intergenic
1051567678 9:18518828-18518850 CTGTAATCCCAGCACTCAGGAGG - Intronic
1051792890 9:20828047-20828069 CTGTTGTCCCAGCACTCAGGAGG + Intronic
1053060871 9:35030391-35030413 CTGTAGTTCAGCTACTCAGGGGG - Intergenic
1053074252 9:35119334-35119356 CTGTAATCCCACTACTCAGGAGG - Intergenic
1053107230 9:35421069-35421091 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1053266210 9:36715524-36715546 CTGTAGATCCACTACTCAGGAGG + Intergenic
1053301432 9:36953813-36953835 CTGTAATTCCAGTACTTTGGGGG + Intronic
1053522978 9:38800133-38800155 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1053601530 9:39615345-39615367 CTGTAGTCCCGCTACTCAGGAGG - Intergenic
1053702405 9:40708754-40708776 CTGTGGTCCCAGTAAAGAGGAGG - Intergenic
1053859180 9:42369110-42369132 CTGTAGTCCCACTACTCAGGAGG - Intergenic
1054195205 9:62024554-62024576 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1054252003 9:62727101-62727123 CTGTAGTCCCACTACTCAGGAGG + Intergenic
1054412464 9:64832212-64832234 CTGTGGTCCCAGTAAAGAGGAGG - Intergenic
1054566117 9:66761602-66761624 CTGTAGTCCCACTACTCAGGAGG + Intergenic
1054643203 9:67564135-67564157 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1054724182 9:68633926-68633948 CTATAATCCCAGTACTCAGGAGG + Intergenic
1054735782 9:68748741-68748763 CTGTAATCCCACTACTCAGGAGG - Intronic
1055244919 9:74228376-74228398 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1055423442 9:76168271-76168293 CTGTAGTCCCACTACTCAGGGGG - Intronic
1055504471 9:76933829-76933851 CTGTAGTCCCAGTACTTGGGAGG - Intergenic
1055656723 9:78457661-78457683 CTCTTGTTCCAGTTCTCAGAGGG - Intergenic
1055798468 9:80003288-80003310 CTATAGTCCCAGTACTCAGGAGG - Intergenic
1055830288 9:80370304-80370326 CTGTAGTCCCACTACTCGGGAGG - Intergenic
1056182360 9:84097698-84097720 CTGTAGTCCCACTACTCTGGAGG + Intergenic
1056948435 9:91021704-91021726 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1057029075 9:91759872-91759894 CAGTGGGACCAGTACTCAGATGG + Intronic
1057340121 9:94193032-94193054 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1058160037 9:101559969-101559991 GTCTTGTTCCAGTTCTCAGGGGG + Intronic
1058288070 9:103205099-103205121 CTGTAGTCCCAGCACTCAGGAGG - Intergenic
1058457980 9:105155939-105155961 CTGTAGTCCCACTACTCAGGAGG + Intergenic
1058784251 9:108370830-108370852 TTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1058849129 9:108993456-108993478 CTGTGGTTTGAATTCTCAGGAGG - Intronic
1058933257 9:109743235-109743257 GTGTAGTTCCAGCACTTAGGTGG + Intronic
1058947662 9:109873882-109873904 CTGTGATCCCAGTACTTGGGAGG + Intronic
1059008356 9:110428945-110428967 CTGTAGTCCCTGCACTCAGGAGG + Intronic
1059075104 9:111184724-111184746 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1059103046 9:111487944-111487966 CTGTGGTCCCAGTACTGGAGAGG + Intergenic
1059142261 9:111864583-111864605 CTGTGGTGCCACTACTCAAGAGG + Intergenic
1059296118 9:113272294-113272316 CTGTGGTCCCAGCACGCGGGAGG + Intronic
1059639677 9:116204534-116204556 CTGTAGTCCCAGTACTTCGGAGG - Intronic
1060310926 9:122461181-122461203 GTTTTGTTCCAGTTCTCAGGTGG + Intergenic
1060314131 9:122492777-122492799 GTTTTGTTCCAGTTCTCAGGGGG + Intergenic
1060606576 9:124920080-124920102 CTGTAATTCCAGTACTTGGGAGG - Intronic
1060612730 9:124983028-124983050 CTGTAGTCCTAGTACTCGGGAGG + Intronic
1060648247 9:125301189-125301211 CTGTAGGCCCAGCACTCAGGAGG - Intronic
1060682020 9:125574752-125574774 CTGCGGTTACAGTAGTTAGGAGG + Intronic
1061029421 9:128070826-128070848 CTGTAATTCCAGTACTCGGGAGG + Intronic
1061470555 9:130821959-130821981 CTGTAGTCCCAGTACTTGGGAGG - Intronic
1061674927 9:132210297-132210319 CTCAAGTCCCAGTACTCAGGAGG + Intronic
1061797383 9:133094830-133094852 CTGTGGTCCCAGCTCTCAAGAGG - Intergenic
1062555346 9:137111277-137111299 CTGTGATCCCAGCACTCTGGGGG + Intronic
1062555364 9:137111334-137111356 CTGTGATCCCAGCACTCTGGGGG + Intronic
1185894728 X:3847702-3847724 CTGTAGTCCAACTACTCAGGAGG - Intergenic
1185899846 X:3886127-3886149 CTGTAGTCCAACTACTCAGGAGG - Intergenic
1185904962 X:3924555-3924577 CTGTAGTCCAACTACTCAGGAGG - Intergenic
1186737242 X:12478459-12478481 CTGTGGCCCCACTACTCAGGAGG + Intronic
1187343359 X:18441291-18441313 CTGTAGTCCCGCTACTCAGGAGG + Intronic
1187591373 X:20720861-20720883 CTGTAATCCCACTACTCAGGAGG - Intergenic
1187657764 X:21497819-21497841 CTGTGGTTCCAGTAATTACATGG - Exonic
1188080453 X:25832734-25832756 CTGTTTTTCCAGTACTTAGGGGG + Intergenic
1188528696 X:31113862-31113884 CTGTGGTTCAGCTACTCAGGAGG + Intronic
1188570260 X:31576836-31576858 CTGTAGTCCCACTACTCAGGAGG - Intronic
1188892244 X:35625594-35625616 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1189218860 X:39353006-39353028 ATCTTGTTCCAGTTCTCAGGAGG + Intergenic
1189408776 X:40750671-40750693 CTGTAGTCCCAGTACTCAGAAGG - Intergenic
1189414051 X:40798813-40798835 CTCTTGTTCCAGTTCTCAGAGGG - Intergenic
1190031168 X:46974281-46974303 CTGTAGTCCCAGTCCTCGGGAGG + Intronic
1190681917 X:52833567-52833589 CTGTGGAGCCAGTTCTCTGGTGG + Intergenic
1191820118 X:65297071-65297093 CTCTTGTTCCAGTTCTCAGGTGG - Intergenic
1191831660 X:65421824-65421846 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1191890938 X:65939926-65939948 CTGTAATCCCACTACTCAGGAGG - Intergenic
1192116435 X:68416162-68416184 CTGTAATCCCACTACTCAGGAGG - Intronic
1192164282 X:68816639-68816661 GTCTTGTTCCAGTTCTCAGGAGG - Intergenic
1192210462 X:69124579-69124601 CTATAGTCCCAGTACTCAGGAGG - Intergenic
1193015698 X:76731187-76731209 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1193118052 X:77794635-77794657 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1193254995 X:79337543-79337565 CTGAGGTTCCAGCACTCTAGTGG - Intergenic
1193539957 X:82759158-82759180 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1193775659 X:85638250-85638272 GTCTTGTTCCAGTTCTCAGGCGG + Intergenic
1193874996 X:86851509-86851531 GTGTTGTTCCAGTTCTCAGCGGG + Intergenic
1193964227 X:87964671-87964693 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1193976755 X:88129732-88129754 TTGTAGTCCCAGTACTCAGGAGG + Intergenic
1194168406 X:90551588-90551610 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1194191708 X:90844846-90844868 GTTTTGTTCCAGTTCTCAGGAGG + Intergenic
1194213987 X:91105949-91105971 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1194224618 X:91240914-91240936 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1194278520 X:91917234-91917256 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1194510412 X:94787078-94787100 GTCTTGTTCCAGTTCTCAGGCGG - Intergenic
1194583265 X:95702307-95702329 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1194606292 X:95982888-95982910 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1194633870 X:96320234-96320256 GTCTGGTTCCAGTTCTCAGGGGG + Intergenic
1195021729 X:100835141-100835163 CTGTAGTGCCAGCACTCTGGAGG + Intronic
1195855219 X:109324314-109324336 CTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1196235824 X:113278627-113278649 CTGTAATCCCGGTACTCAGGAGG + Intergenic
1196519036 X:116651021-116651043 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1196671878 X:118376879-118376901 CTGTAGTCCCAGTACTTGGGAGG + Intronic
1196729334 X:118925392-118925414 CTGTAGTCCAACTACTCAGGAGG - Intergenic
1196746996 X:119079973-119079995 CTCTGGTTCCAGCATTAAGGTGG - Exonic
1196994314 X:121364512-121364534 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1197081447 X:122422804-122422826 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1197371530 X:125632382-125632404 GTGTTGTTCCAGTTCTTAGGGGG - Intergenic
1197956811 X:131959733-131959755 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1198263585 X:134988480-134988502 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1198563674 X:137880979-137881001 CTGTACTCCCACTACTCAGGAGG - Intergenic
1198604175 X:138318495-138318517 GTCTTGTTCCAGTTCTCAGGGGG + Intergenic
1198771118 X:140131043-140131065 CTGTAATTCCAGCACTCTGGGGG - Intergenic
1198828117 X:140719963-140719985 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1198889771 X:141380596-141380618 GTGTTGCTCCAGTTCTCAGGGGG - Intergenic
1199022300 X:142896195-142896217 GTGTTGTTCCAGTTCTCAGTGGG + Intergenic
1199134488 X:144234546-144234568 CTGTAATTCCAGCACTCTGGGGG + Intergenic
1199587175 X:149427505-149427527 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1199650580 X:149943740-149943762 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1199995785 X:153025310-153025332 CTGTAGTCCCACTTCTCAGGAGG - Intergenic
1200139179 X:153889792-153889814 CTGTTGTCCCAGTACTTGGGAGG - Intronic
1200158409 X:153990814-153990836 CTGTAGTCCCACTACTCGGGAGG - Intergenic
1200169015 X:154058512-154058534 CTGTCGTTCCAGGACCCAGGAGG - Intronic
1200333026 X:155318128-155318150 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1200340147 X:155388103-155388125 ATCTTGTTCCAGTTCTCAGGGGG + Intergenic
1200514650 Y:4129375-4129397 GTCTTGTTCCAGTTCTCAGGGGG - Intergenic
1200538351 Y:4427280-4427302 GTTTTGTTCCAGTTCTCAGGAGG + Intergenic
1200561082 Y:4704224-4704246 GTCTTGTTCCAGTTCTCAGGAGG + Intergenic
1200595853 Y:5139313-5139335 GTCTTGTTCCAGTTCTCAGGGGG - Intronic
1200881387 Y:8216328-8216350 CTTTGGTCCAACTACTCAGGAGG - Intergenic
1201260619 Y:12155591-12155613 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1201646780 Y:16242075-16242097 CTGTAGTTCCAGTACTTGGGAGG + Intergenic
1201647727 Y:16253978-16254000 CCCTAGTTCCAGTACTCGGGAGG + Intergenic
1201655084 Y:16331319-16331341 CCCTAGTTCCAGTACTCGGGAGG - Intergenic
1201656033 Y:16343242-16343264 CTGTAGTTCCAGTACTTGGGAGG - Intergenic
1201726581 Y:17158703-17158725 CTGTAGTCCCAGAACTCGGGAGG + Intergenic