ID: 1020049705

View in Genome Browser
Species Human (GRCh38)
Location 7:5073236-5073258
Sequence TTTTGGGATGGGCCCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020049705 Original CRISPR TTTTGGGATGGGCCCGTGCC TGG Intergenic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
906208529 1:43999658-43999680 TTGTGGGATGTTCCCGAGCCTGG - Intronic
908390737 1:63681306-63681328 TTCTGGGATGAGCCCATGGCTGG - Intergenic
916011792 1:160712740-160712762 TATAGGCATGGGCCTGTGCCTGG + Intergenic
917922136 1:179759534-179759556 TCTTGGGATGGTCTCTTGCCAGG - Intronic
922966464 1:229694958-229694980 GTGTGGGGTGGGCCCGTGCCTGG - Intergenic
1067356340 10:45531853-45531875 TTTTGGGTTGAACCTGTGCCAGG + Intronic
1068840845 10:61612191-61612213 TAGTGTGTTGGGCCCGTGCCAGG + Intergenic
1069829063 10:71271642-71271664 TGCTGGGATGAGCCCGGGCCTGG - Intronic
1070610247 10:77927282-77927304 TTGTGGGCTGGCCGCGTGCCAGG - Intergenic
1072538023 10:96377981-96378003 CTGTGAGATGGGCCCGGGCCAGG - Intronic
1072545198 10:96431953-96431975 TCTTGGGATGGGCACATGGCTGG + Intronic
1075057742 10:119232541-119232563 TTGTGGGAGGGGCCCGTGGGAGG + Intronic
1075615943 10:123891247-123891269 GTCTGGGATGGGCCAGTCCCGGG - Intronic
1077369759 11:2175994-2176016 ATTTGGGAAGGGCCCGTGGTGGG - Intergenic
1077487139 11:2844247-2844269 TTGTGGGAAGGGCCCAGGCCTGG - Intronic
1079549569 11:21677306-21677328 TATTGGGATGGACCAGTCCCTGG - Intergenic
1080944794 11:36958749-36958771 TTTTAGGATTGCCCAGTGCCAGG + Intergenic
1080958057 11:37124438-37124460 TTTTGTGATGGTCTGGTGCCTGG + Intergenic
1083398210 11:62405777-62405799 TACTGGGAGGGGCCCGGGCCTGG - Intronic
1084153925 11:67303573-67303595 TTGAGGGAAGGGGCCGTGCCCGG + Exonic
1084175031 11:67418574-67418596 TTTTGGGATGTGGCTGGGCCAGG - Intronic
1084683275 11:70679461-70679483 TTTTGGGGTGTGCACCTGCCTGG + Intronic
1087307459 11:96502930-96502952 TTTTAGGATGGGCCCATGTGAGG - Intronic
1089453516 11:118612559-118612581 TCTTGGGGTGGGCCCCAGCCTGG + Intronic
1090101054 11:123797272-123797294 TTATGGGATAAGCCCGTGCTAGG - Intergenic
1096977242 12:55706620-55706642 TTTTGTGAGGGGCCTGTGACTGG - Intronic
1097791378 12:63818593-63818615 TTTTTGGATGGTCCCTGGCCTGG - Intergenic
1102159593 12:110757700-110757722 TTTGTGCCTGGGCCCGTGCCTGG + Intergenic
1102900544 12:116633210-116633232 TTTGGGGAGGGGGCCGTGCTGGG + Intergenic
1104822209 12:131683723-131683745 TTTCTGGGTGGGGCCGTGCCTGG + Intergenic
1104951952 12:132445167-132445189 TGTTTGGCTGGGCCCGGGCCAGG - Intergenic
1107146137 13:37062179-37062201 TTTTGGGATGAGACTCTGCCTGG - Intergenic
1113627847 13:111859486-111859508 GTTTGGAATGGCCCTGTGCCTGG - Intergenic
1118910654 14:70059612-70059634 TTTAGGGATGAGCCCCTGGCAGG + Intronic
1119853140 14:77880323-77880345 TTCTGGGATTGGCCCTTGTCAGG + Intronic
1121777235 14:96598680-96598702 TGAGGGGATGGGCCCGAGCCAGG + Intergenic
1123103327 14:105820407-105820429 TATTTGGATGGGCCTGTCCCAGG + Intergenic
1126752791 15:51894376-51894398 TTTTGAGATGGGACAGTGGCAGG - Intronic
1129194220 15:73954651-73954673 TCTAGGGAGGGGCCCGAGCCAGG - Intergenic
1130095284 15:80851094-80851116 TGTTGGCAGGGGCCAGTGCCAGG + Intronic
1132215279 15:100057678-100057700 TTGGGTGATGGGCCTGTGCCTGG - Intronic
1139407287 16:66729247-66729269 TTTTGGGAGAGGTCTGTGCCAGG - Intronic
1144786974 17:17837296-17837318 GTTTGGGATGGGCCCAGGCCTGG - Intergenic
1144816419 17:18038839-18038861 TTTTGGGTTGGGGCCGAGCTGGG - Intronic
1150176793 17:63066094-63066116 TATTGGGATGGGCCTGGACCTGG + Intronic
1152598638 17:81250476-81250498 TCCTGGGAGGTGCCCGTGCCAGG + Intronic
1152633584 17:81421387-81421409 TTTGGGGATGGCACCGTGACTGG - Intronic
1156444189 18:37222806-37222828 TTATGGGATGGGCAGCTGCCAGG - Exonic
1158514346 18:58118981-58119003 CTTTGGGATGACCCCGGGCCTGG - Intronic
1160553439 18:79711002-79711024 TATTGGGATGGGGCAGAGCCTGG - Intronic
1162413088 19:10517970-10517992 AATTGGGAGGGGCCTGTGCCCGG - Intergenic
1162895255 19:13761588-13761610 TTGTGGGATGAGGCCGTGCGTGG + Intronic
1163238515 19:16043769-16043791 TTTAGGGATGGGCCAGAGCAAGG + Intergenic
1163282767 19:16327080-16327102 GTTTGGGAGGGGGCCGCGCCCGG - Exonic
1163375353 19:16927026-16927048 GTTTGGGATGGGCCTGAGTCAGG - Intronic
927537344 2:23874168-23874190 TTTTGGGATGGAGCCTTCCCTGG - Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928374645 2:30764677-30764699 TTAAGGGATGGTCACGTGCCGGG - Intronic
928651824 2:33411856-33411878 TTTTGGTCTGGGCCAGTCCCTGG + Intergenic
929883048 2:45853966-45853988 TGGTGGGATGGGCCCGTGTGTGG - Intronic
931779313 2:65565832-65565854 TTCTGGGCTGGGCCTGCGCCAGG + Intergenic
937228735 2:120384649-120384671 TTAGGGGATGGGCCTATGCCTGG + Intergenic
947915612 2:233830157-233830179 TGTTGGGATGGGAGCGGGCCTGG + Intronic
948874153 2:240818485-240818507 GTGTGGGATGGGCCAGGGCCAGG - Intronic
1169029419 20:2396294-2396316 TTTTGGGATTGGTCCCTGCTTGG + Intronic
1172883287 20:38215378-38215400 TTGTGGGCCGAGCCCGTGCCAGG + Intronic
1175932020 20:62497837-62497859 TGTTGGGATGGGTCCGTGTTGGG + Intergenic
1175932067 20:62497966-62497988 TGTTGGGATGGGTCCGTGTTGGG + Intergenic
1175932271 20:62498520-62498542 TGTTGGGATGGGTCCGTGTTGGG + Intergenic
1176959328 21:15141653-15141675 CTTTGTGATGGCCTCGTGCCAGG + Intergenic
1179281554 21:39938430-39938452 TATTGGGTTGGCTCCGTGCCTGG - Intergenic
1179423439 21:41254065-41254087 TTTTAGGATGGGGCCCTACCTGG + Intronic
1179768382 21:43592875-43592897 TTTTGGGATTGAACCGTGGCTGG + Intronic
1182279417 22:29209239-29209261 TTGTGGGAGTGGCCGGTGCCAGG + Intronic
952538924 3:34345614-34345636 TATTGGGATTGTCCGGTGCCTGG + Intergenic
954377877 3:50204562-50204584 TTTTAGGATGGCCCCGTTCTTGG - Intergenic
954656448 3:52197213-52197235 TGTTGGGCTGGGCCTGTGCCAGG - Intergenic
955851721 3:63227151-63227173 TTTTGGGAGGGGCTAGGGCCGGG + Intergenic
956271354 3:67450774-67450796 TTCTGGGATGGGCCAAGGCCTGG - Intronic
960501653 3:118445274-118445296 TTATGGGATGGGGGCGTGGCAGG + Intergenic
963168978 3:142232141-142232163 TCTTGGCAGGGGCCCATGCCAGG - Intergenic
963269067 3:143267867-143267889 TTGTAGAATGGGCCCTTGCCGGG + Intronic
966863664 3:184244359-184244381 TTTTGAGATGGGCTCTTGCTGGG - Intronic
968234554 3:197024025-197024047 TCATGGGCTGGGCCTGTGCCTGG + Intronic
968602763 4:1518129-1518151 TGCTGGGAAGGGCCGGTGCCAGG - Intergenic
972059738 4:34854595-34854617 TTTTGGAATGCCCCAGTGCCAGG + Intergenic
982327336 4:154141966-154141988 TATTTGTATGGGCCTGTGCCTGG - Intergenic
988170828 5:27653093-27653115 TTTTGGGAAGGGCCAGGGGCAGG + Intergenic
990755380 5:59063590-59063612 TTTTGAGATGGGTCAGGGCCAGG + Intronic
991520778 5:67494671-67494693 TTACGGGAAGGGTCCGTGCCAGG - Intergenic
996085045 5:119296589-119296611 TTTTTGGTTGTGCCTGTGCCCGG + Intronic
996245581 5:121260129-121260151 TTTTGGGTTGTGTCCCTGCCAGG + Intergenic
998405460 5:141872017-141872039 TTTAGGGAGGGGCCTGTGCTTGG - Intronic
1001020171 5:168176025-168176047 TTTTGGGATGCCCCCTTACCTGG + Intronic
1001961301 5:175881800-175881822 TTTTGGGATAGGCCCTGGCGGGG - Exonic
1002573915 5:180161022-180161044 TTTAGTGATGGGCCCCTTCCCGG - Intronic
1013630991 6:111985839-111985861 GTTTGGGGTGGGCCCCAGCCCGG - Intergenic
1017034623 6:150256038-150256060 GGTGGGGATGGGCCCGTGCAAGG - Intergenic
1018750405 6:166799223-166799245 GCTGGGGATGGGCCCCTGCCCGG - Intronic
1020049705 7:5073236-5073258 TTTTGGGATGGGCCCGTGCCTGG + Intergenic
1023591707 7:41787482-41787504 ATTTGGGATGGGCACGTGGCAGG + Intergenic
1024294704 7:47832939-47832961 GTTTTGGGTGGGCCCATGCCTGG + Intronic
1032487484 7:132298696-132298718 TTTGGGGTTGGCCCCCTGCCTGG - Intronic
1033338198 7:140471091-140471113 TTTGGGGATGGGCCAGTTTCTGG + Intronic
1034333485 7:150304675-150304697 TTTTGAGATGGGGCAGTGCATGG - Intronic
1034664558 7:152805215-152805237 TTTTGAGATGGGGCAGTGCATGG + Intronic
1037787308 8:21910728-21910750 CTGTGGGGTGGGCCCGAGCCAGG - Exonic
1038479810 8:27893986-27894008 TTTGGGGATGGCCCTGAGCCAGG - Intronic
1040858014 8:51970313-51970335 TATGGGGATGGCACCGTGCCTGG + Intergenic
1040990177 8:53341324-53341346 TTTTTGGTTGTGCCTGTGCCCGG - Intergenic
1047284532 8:123475994-123476016 TTTAGGGATGGGGTCTTGCCAGG + Intergenic
1051249548 9:15145637-15145659 TTTTGGCATGGGCCCAGGCTGGG - Intergenic
1058079504 9:100687320-100687342 TTTTGTAATGGGCAGGTGCCTGG + Intergenic
1061925521 9:133804359-133804381 TCTTGGGCTGGGCCTGTGACTGG + Intronic
1061971938 9:134049797-134049819 CTTTGGGCAGGGCCCGTGCCAGG - Intronic
1062313396 9:135952264-135952286 TTTTGGGCTAGGCCCATGCCTGG - Intronic
1203666387 Un_KI270754v1:22845-22867 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203667537 Un_KI270754v1:28484-28506 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203668685 Un_KI270754v1:34123-34145 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1190047967 X:47127767-47127789 TTTTGGGCTGGGCTGCTGCCTGG + Intergenic
1192248040 X:69389276-69389298 ATCTGGGATGGGCCTGAGCCTGG - Intergenic
1192655813 X:72992881-72992903 TTTTGGTATGTGTCCCTGCCAGG - Intergenic
1199074536 X:143513176-143513198 TTTTAGGATGGGCCCATGTGAGG - Intronic
1199093542 X:143716448-143716470 TTTTAGGATGGGCCCATGTGAGG - Intronic
1199214793 X:145251759-145251781 TTTTAGGATGGGCCCATGTGAGG + Intronic
1202583838 Y:26405307-26405329 TTCAGGGAAGGGCCAGTGCCAGG + Intergenic