ID: 1020049962

View in Genome Browser
Species Human (GRCh38)
Location 7:5074956-5074978
Sequence AATTATATGCAGTATTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020049962_1020049970 29 Left 1020049962 7:5074956-5074978 CCTGCCAAATACTGCATATAATT No data
Right 1020049970 7:5075008-5075030 AAATCTCAGGCCAGGCACAATGG No data
1020049962_1020049969 21 Left 1020049962 7:5074956-5074978 CCTGCCAAATACTGCATATAATT No data
Right 1020049969 7:5075000-5075022 AAAGGGCAAAATCTCAGGCCAGG No data
1020049962_1020049966 4 Left 1020049962 7:5074956-5074978 CCTGCCAAATACTGCATATAATT No data
Right 1020049966 7:5074983-5075005 CCTTGATGAAATCCTAGAAAGGG No data
1020049962_1020049968 16 Left 1020049962 7:5074956-5074978 CCTGCCAAATACTGCATATAATT No data
Right 1020049968 7:5074995-5075017 CCTAGAAAGGGCAAAATCTCAGG No data
1020049962_1020049964 3 Left 1020049962 7:5074956-5074978 CCTGCCAAATACTGCATATAATT No data
Right 1020049964 7:5074982-5075004 TCCTTGATGAAATCCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020049962 Original CRISPR AATTATATGCAGTATTTGGC AGG (reversed) Intergenic
No off target data available for this crispr