ID: 1020052142

View in Genome Browser
Species Human (GRCh38)
Location 7:5088679-5088701
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020052142_1020052150 24 Left 1020052142 7:5088679-5088701 CCCGCCTCTCTCCAGAAGAACAG No data
Right 1020052150 7:5088726-5088748 AAATTGTAGTTGCTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020052142 Original CRISPR CTGTTCTTCTGGAGAGAGGC GGG (reversed) Intergenic
No off target data available for this crispr