ID: 1020052226

View in Genome Browser
Species Human (GRCh38)
Location 7:5089247-5089269
Sequence TCTTGCATGCAGTTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020052226_1020052229 -2 Left 1020052226 7:5089247-5089269 CCTTCCACCAACTGCATGCAAGA No data
Right 1020052229 7:5089268-5089290 GAAAACCTCTCACCTCTACCAGG No data
1020052226_1020052230 2 Left 1020052226 7:5089247-5089269 CCTTCCACCAACTGCATGCAAGA No data
Right 1020052230 7:5089272-5089294 ACCTCTCACCTCTACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020052226 Original CRISPR TCTTGCATGCAGTTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr