ID: 1020054635

View in Genome Browser
Species Human (GRCh38)
Location 7:5108936-5108958
Sequence GCCTAGCTTTTGTCTTCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020054635_1020054644 25 Left 1020054635 7:5108936-5108958 CCAGGCGAAGACAAAAGCTAGGC No data
Right 1020054644 7:5108984-5109006 TGATCTTGGGGCACTCTCAGTGG No data
1020054635_1020054641 11 Left 1020054635 7:5108936-5108958 CCAGGCGAAGACAAAAGCTAGGC No data
Right 1020054641 7:5108970-5108992 GGAACTGGAAAATTTGATCTTGG No data
1020054635_1020054642 12 Left 1020054635 7:5108936-5108958 CCAGGCGAAGACAAAAGCTAGGC No data
Right 1020054642 7:5108971-5108993 GAACTGGAAAATTTGATCTTGGG No data
1020054635_1020054637 -10 Left 1020054635 7:5108936-5108958 CCAGGCGAAGACAAAAGCTAGGC No data
Right 1020054637 7:5108949-5108971 AAAGCTAGGCTCCTGCCTCAGGG No data
1020054635_1020054643 13 Left 1020054635 7:5108936-5108958 CCAGGCGAAGACAAAAGCTAGGC No data
Right 1020054643 7:5108972-5108994 AACTGGAAAATTTGATCTTGGGG No data
1020054635_1020054638 -4 Left 1020054635 7:5108936-5108958 CCAGGCGAAGACAAAAGCTAGGC No data
Right 1020054638 7:5108955-5108977 AGGCTCCTGCCTCAGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020054635 Original CRISPR GCCTAGCTTTTGTCTTCGCC TGG (reversed) Intergenic