ID: 1020058119

View in Genome Browser
Species Human (GRCh38)
Location 7:5132579-5132601
Sequence TCCCACCTGCGCCTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020058119_1020058123 -5 Left 1020058119 7:5132579-5132601 CCCTCTCCCAGGCGCAGGTGGGA No data
Right 1020058123 7:5132597-5132619 TGGGAGAAAACCTCCTCTGAAGG No data
1020058119_1020058124 -4 Left 1020058119 7:5132579-5132601 CCCTCTCCCAGGCGCAGGTGGGA No data
Right 1020058124 7:5132598-5132620 GGGAGAAAACCTCCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020058119 Original CRISPR TCCCACCTGCGCCTGGGAGA GGG (reversed) Intergenic