ID: 1020063269

View in Genome Browser
Species Human (GRCh38)
Location 7:5168500-5168522
Sequence AGCAAGGACTGACCTTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020063265_1020063269 12 Left 1020063265 7:5168465-5168487 CCTGTCTCAAAAAAAAAAAAAAA 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
Right 1020063269 7:5168500-5168522 AGCAAGGACTGACCTTCACAGGG No data
1020063264_1020063269 13 Left 1020063264 7:5168464-5168486 CCCTGTCTCAAAAAAAAAAAAAA 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
Right 1020063269 7:5168500-5168522 AGCAAGGACTGACCTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020063269 Original CRISPR AGCAAGGACTGACCTTCACA GGG Intergenic
No off target data available for this crispr