ID: 1020063543

View in Genome Browser
Species Human (GRCh38)
Location 7:5170288-5170310
Sequence CGCTGAGCCTTTGTGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020063543_1020063548 2 Left 1020063543 7:5170288-5170310 CCAGCACCCACAAAGGCTCAGCG No data
Right 1020063548 7:5170313-5170335 ATGCAGCAGTGTGGTGCGATTGG No data
1020063543_1020063550 26 Left 1020063543 7:5170288-5170310 CCAGCACCCACAAAGGCTCAGCG No data
Right 1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG No data
1020063543_1020063547 -7 Left 1020063543 7:5170288-5170310 CCAGCACCCACAAAGGCTCAGCG No data
Right 1020063547 7:5170304-5170326 CTCAGCGGCATGCAGCAGTGTGG No data
1020063543_1020063549 13 Left 1020063543 7:5170288-5170310 CCAGCACCCACAAAGGCTCAGCG No data
Right 1020063549 7:5170324-5170346 TGGTGCGATTGGAGTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020063543 Original CRISPR CGCTGAGCCTTTGTGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr