ID: 1020063546

View in Genome Browser
Species Human (GRCh38)
Location 7:5170295-5170317
Sequence TGCATGCCGCTGAGCCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020063546_1020063548 -5 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063548 7:5170313-5170335 ATGCAGCAGTGTGGTGCGATTGG No data
1020063546_1020063550 19 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG No data
1020063546_1020063554 27 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063554 7:5170345-5170367 GGTTCCTAGAATTGGAGTAAGGG No data
1020063546_1020063549 6 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063549 7:5170324-5170346 TGGTGCGATTGGAGTCCCTCTGG No data
1020063546_1020063553 26 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063553 7:5170344-5170366 TGGTTCCTAGAATTGGAGTAAGG No data
1020063546_1020063555 28 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063555 7:5170346-5170368 GTTCCTAGAATTGGAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020063546 Original CRISPR TGCATGCCGCTGAGCCTTTG TGG (reversed) Intergenic
No off target data available for this crispr