ID: 1020063550

View in Genome Browser
Species Human (GRCh38)
Location 7:5170337-5170359
Sequence GTCCCTCTGGTTCCTAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020063545_1020063550 20 Left 1020063545 7:5170294-5170316 CCCACAAAGGCTCAGCGGCATGC No data
Right 1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG No data
1020063546_1020063550 19 Left 1020063546 7:5170295-5170317 CCACAAAGGCTCAGCGGCATGCA No data
Right 1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG No data
1020063543_1020063550 26 Left 1020063543 7:5170288-5170310 CCAGCACCCACAAAGGCTCAGCG No data
Right 1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020063550 Original CRISPR GTCCCTCTGGTTCCTAGAAT TGG Intergenic
No off target data available for this crispr