ID: 1020065742

View in Genome Browser
Species Human (GRCh38)
Location 7:5187279-5187301
Sequence CAGAGGCTAAGGCGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020065742_1020065751 -4 Left 1020065742 7:5187279-5187301 CCATCCTCCCGCCTTAGCCTCTG No data
Right 1020065751 7:5187298-5187320 TCTGAAGGAGCTGGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020065742 Original CRISPR CAGAGGCTAAGGCGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr