ID: 1020066312

View in Genome Browser
Species Human (GRCh38)
Location 7:5190659-5190681
Sequence CGCCCTCCAGGGAGACCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020066308_1020066312 -3 Left 1020066308 7:5190639-5190661 CCGGGGCGTGCAGGGAGGGGCGC 0: 1
1: 0
2: 1
3: 40
4: 327
Right 1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG 0: 1
1: 0
2: 0
3: 29
4: 215
1020066307_1020066312 -2 Left 1020066307 7:5190638-5190660 CCCGGGGCGTGCAGGGAGGGGCG 0: 1
1: 0
2: 2
3: 51
4: 455
Right 1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG 0: 1
1: 0
2: 0
3: 29
4: 215
1020066300_1020066312 10 Left 1020066300 7:5190626-5190648 CCCAGGGGCGGGCCCGGGGCGTG 0: 1
1: 0
2: 7
3: 39
4: 312
Right 1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG 0: 1
1: 0
2: 0
3: 29
4: 215
1020066290_1020066312 30 Left 1020066290 7:5190606-5190628 CCAAGGCGCGCAGAGGCGTCCCC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG 0: 1
1: 0
2: 0
3: 29
4: 215
1020066299_1020066312 11 Left 1020066299 7:5190625-5190647 CCCCAGGGGCGGGCCCGGGGCGT 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG 0: 1
1: 0
2: 0
3: 29
4: 215
1020066301_1020066312 9 Left 1020066301 7:5190627-5190649 CCAGGGGCGGGCCCGGGGCGTGC 0: 1
1: 0
2: 10
3: 63
4: 462
Right 1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG 0: 1
1: 0
2: 0
3: 29
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020066312 Original CRISPR CGCCCTCCAGGGAGACCCTC GGG Intronic
900374089 1:2345427-2345449 CGTCCTCCTTGGAGAGCCTCGGG + Intronic
900420149 1:2552770-2552792 CTCCCCCCAGGGAGACCCCCTGG + Intergenic
900424282 1:2568888-2568910 CTCCCCCCAGGGAGACCCCCTGG - Intergenic
900616442 1:3567687-3567709 CGGCCTGCAGGGTGACGCTCTGG - Intronic
900704138 1:4068293-4068315 CCCCTTCCAGAGAGACCCTGCGG - Intergenic
901791064 1:11654015-11654037 CCCCCGCCAGACAGACCCTCAGG + Intronic
902623519 1:17664043-17664065 CGCCCTCTAGGAAGCCCCACTGG - Intronic
902917692 1:19648510-19648532 GGCCTTCCTGGGGGACCCTCTGG + Intronic
903430077 1:23290132-23290154 AGCCATTCAGGGAGCCCCTCAGG - Intergenic
903953212 1:27008404-27008426 CGCCCTCCAGGAAGACTTCCGGG + Intronic
904390829 1:30184686-30184708 TTTCCTCCAGGGAGTCCCTCTGG + Intergenic
904822615 1:33255852-33255874 CGTCTTCGAGGGAGACCCCCAGG + Intergenic
904925092 1:34041330-34041352 GGCATTCCAGGAAGACCCTCAGG - Intronic
905794339 1:40807209-40807231 GTCCCTCCAGGGACAGCCTCAGG + Intronic
905945522 1:41898315-41898337 CCCCCTCCAGGGAGACTGCCAGG - Intronic
906223712 1:44103777-44103799 CGGCCTCCAGGGAAGCCCTCTGG + Intergenic
913971549 1:143421406-143421428 CCCCCTCCAGGGATCCCTTCAGG + Intergenic
913978017 1:143480789-143480811 CCCCCTCCAGGATTACCCTCAGG + Intergenic
914065926 1:144247019-144247041 CCCCCTCCAGGGATCCCTTCAGG + Intergenic
914072420 1:144306418-144306440 CCCCCTCCAGGATTACCCTCAGG + Intergenic
914106734 1:144659938-144659960 CCCCCTCCAGGATTACCCTCAGG - Intergenic
914113225 1:144719335-144719357 CCCCCTCCAGGGATCCCTTCAGG - Intergenic
914381981 1:147124644-147124666 CCCCCTCAATGGTGACCCTCAGG - Intergenic
915619806 1:157074230-157074252 CGGCCTCCAGGGAAGCCCTCTGG - Intergenic
915837715 1:159191062-159191084 CGCCTACCGGGGAGCCCCTCAGG - Intronic
915909959 1:159908763-159908785 CGCCGTGCAGGGAGAACCTGGGG - Intergenic
919829538 1:201530890-201530912 CGCCAACCAGGGAGAGCCCCAGG - Intergenic
919924041 1:202183118-202183140 CTCCCACCAGGTAGACCCACCGG + Intergenic
1063714553 10:8514138-8514160 CGGCCTCCAGGGAAGCCTTCTGG + Intergenic
1069917524 10:71796507-71796529 TCCCCTCCAGGGAACCCCTCAGG + Intronic
1073179447 10:101574982-101575004 TGCCCTCCAGGGGCAACCTCGGG + Intronic
1075932721 10:126313076-126313098 CACCCTCATGAGAGACCCTCAGG - Intronic
1076374287 10:129973009-129973031 CGCCCTCCCGGGAGAGCCCACGG + Intergenic
1076668273 10:132105002-132105024 CCCACTCCAGGAAGAGCCTCTGG - Intronic
1077284617 11:1760118-1760140 TGCCCTCCAGGGTGAACCCCAGG + Intronic
1077308329 11:1877621-1877643 CCCCCTCCAGGGATCCCTTCAGG - Intronic
1077333223 11:1992528-1992550 CACCGTTCAGGGAGACCCTGAGG - Intergenic
1077384704 11:2263415-2263437 CCCCCTCCAGGCAGACCCAAGGG + Intergenic
1077730342 11:4723186-4723208 CGGCCTCCAGGGAAGCCCTCTGG + Intronic
1078191523 11:9095460-9095482 CAGCCTCCAGGGAAACCCTCTGG - Intronic
1079010775 11:16826400-16826422 TGCCCTCCAGTGGGTCCCTCTGG + Exonic
1079031671 11:16990842-16990864 AACTCTACAGGGAGACCCTCAGG + Intronic
1080802236 11:35619089-35619111 CGCGCTCCAGGGCCACCATCCGG - Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083296491 11:61718187-61718209 AGCCCTCCAGCCAGCCCCTCTGG + Intronic
1083996632 11:66276277-66276299 CCCCCTCCAGGGACATCATCTGG - Exonic
1084424097 11:69075098-69075120 GGACCTCCAGGGAGACCACCAGG - Intronic
1084488965 11:69467877-69467899 CGCCCTTCAGGGAGGCCCCGAGG + Intergenic
1087283977 11:96244188-96244210 TACCCTCCAGGGAGACACTGAGG - Intronic
1089599239 11:119603306-119603328 CGGCCTCCAGGGAAGTCCTCTGG + Intergenic
1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG + Intronic
1202816203 11_KI270721v1_random:47709-47731 CACCGTTCAGGGAGACCCTGAGG - Intergenic
1091801433 12:3327033-3327055 CGCCCTCCCGTGGCACCCTCTGG - Intergenic
1092270404 12:7018793-7018815 AGCCCTCCGGGGCGACCGTCCGG + Intronic
1092879640 12:12878053-12878075 CTGCCTCCAGAGAGGCCCTCTGG - Intergenic
1094069064 12:26393002-26393024 CACCCTCCAGGGCCACCTTCTGG + Intronic
1094494374 12:30980210-30980232 ATCCCTCCAGGGACACCCACTGG + Intronic
1094826722 12:34275284-34275306 CCCACTCCAGGGACACCCTTGGG + Intergenic
1097615559 12:61880300-61880322 TGGCCTCCAGGGAAGCCCTCTGG - Intronic
1098264693 12:68706607-68706629 CGGCCTCCAGGGAAGCCCTCTGG - Intronic
1100309354 12:93379243-93379265 CGCTCTCCAGGGAAACCCCAAGG - Intronic
1103902821 12:124312045-124312067 TACCCTCCAGGCAGCCCCTCTGG + Intronic
1103931925 12:124455375-124455397 CCCCCTCCAGGCACATCCTCGGG - Intronic
1104836548 12:131795671-131795693 TGCCTTCCAGGGAGACCTCCAGG - Intronic
1104984244 12:132587651-132587673 CCCCATCCAGGCAGTCCCTCTGG + Intergenic
1105221336 13:18330671-18330693 CTCCCTCCAGGATTACCCTCAGG - Intergenic
1114683327 14:24505647-24505669 CCCCCTACAGGGAGACTCTGGGG - Exonic
1115951614 14:38728010-38728032 CGGTCTCCAGGGAAGCCCTCTGG - Intergenic
1116326911 14:43541327-43541349 AGGCCTCCAGGGAAGCCCTCTGG + Intergenic
1122182575 14:99966892-99966914 CGGGCTCCAGGGGGACCCTTAGG + Intergenic
1122242978 14:100381519-100381541 CGCCCTGCAGGGGGCCCCTGTGG - Exonic
1122804704 14:104250493-104250515 CCCCCACCAGACAGACCCTCAGG - Intergenic
1122999881 14:105287622-105287644 GGCCCTCCAGGGAAACCATGAGG + Intronic
1125322029 15:38499227-38499249 CCTACTCTAGGGAGACCCTCCGG + Intronic
1125841040 15:42801414-42801436 CAGCCTCCAGGGAAGCCCTCTGG + Intronic
1127638233 15:60891420-60891442 AAGCATCCAGGGAGACCCTCAGG + Intronic
1129229531 15:74189089-74189111 AGGCCTCCAGGGAGCCCCTGAGG - Intronic
1129253153 15:74319620-74319642 CCTCCTCCAGGAAGACCCCCGGG - Intronic
1129597939 15:76979452-76979474 CGGCCTCCAGGGAAGCCCTCTGG + Intergenic
1131064153 15:89422626-89422648 CTCCCTCCAGGAACACCCCCTGG - Intergenic
1132518713 16:377702-377724 CGCTCTCCCGGGAGACCTGCAGG + Exonic
1138513251 16:57521031-57521053 CCGCCTCCAGGAAGACCCTCTGG + Intronic
1140753731 16:78048899-78048921 TGGCCTCCAGGGAAGCCCTCTGG + Intronic
1141595173 16:85092949-85092971 CGCCCTCCATACAGGCCCTCAGG + Exonic
1141969612 16:87472187-87472209 GGCCCTACAGTCAGACCCTCGGG + Intronic
1141980362 16:87546491-87546513 CACATTCCAGGGTGACCCTCAGG - Intergenic
1142218600 16:88841862-88841884 CCGCCTCCAGGGACACCCTTGGG - Intronic
1142957311 17:3530676-3530698 CGCCCTACAGGGAGGCCCGTGGG + Intronic
1143030236 17:3963730-3963752 AGCCCTCAGGGGAGACCCTGGGG + Intronic
1143189529 17:5031667-5031689 CGCCCGCCCGGGAGACTCACAGG - Intergenic
1145817909 17:27808801-27808823 GGCCCTCCCGGGAGCCCCTGGGG - Intronic
1147350078 17:39835406-39835428 CGGCCTCCAGGGAAGCCCTCTGG + Intronic
1147776782 17:42907513-42907535 TGCCCTTTAGGGAGCCCCTCTGG + Exonic
1150108245 17:62478103-62478125 CGCCCTCCCGGGCGACGCGCGGG + Intronic
1150773327 17:68059942-68059964 CGCCCTCCAGGGTGTTCCTGGGG - Intergenic
1151988523 17:77559130-77559152 AGCCCTCCAGGGACACCACCTGG - Intergenic
1152581117 17:81166007-81166029 CGCCCTCCCGGGATGCCCGCCGG - Exonic
1152739357 17:82012287-82012309 AGCACCCCAGGGAGGCCCTCAGG - Intronic
1156228425 18:35131139-35131161 CGCTCTCCAGGGAGAAACTGAGG - Intronic
1157063565 18:44321237-44321259 CGGCCTCCAGGAAAGCCCTCAGG + Intergenic
1157683559 18:49625661-49625683 CGCCCTCTAAGGACACACTCTGG - Intergenic
1160709070 19:542484-542506 CTCCGTCCAGGCACACCCTCGGG + Intergenic
1160944987 19:1637402-1637424 TGCCCTCCAGGGAAACCCCAGGG - Intronic
1161010433 19:1957184-1957206 CTCCCTCCAGGCAGCCCCACAGG + Intronic
1161548284 19:4895745-4895767 GGCCCCACAGGGTGACCCTCAGG - Intronic
1161722191 19:5909210-5909232 CACCCTGCAGGGGGACCCTACGG + Exonic
1162711331 19:12597035-12597057 CACGCTGCTGGGAGACCCTCGGG + Intronic
1162791592 19:13065841-13065863 AGCCCTCCAGGGAGTTCTTCTGG - Intronic
1162811089 19:13164605-13164627 CCTCGTCCAGGAAGACCCTCTGG - Intergenic
1165348157 19:35261915-35261937 GTCCCTCCAGGGAGGACCTCAGG + Exonic
1166390639 19:42407162-42407184 CGCCCTCCTTGGTGAGCCTCAGG - Exonic
1166678592 19:44754292-44754314 CTCCCGCCTGGGGGACCCTCTGG - Intronic
1166709363 19:44926946-44926968 CCGCCTCCAGGGTGCCCCTCCGG + Intergenic
1168289907 19:55352593-55352615 CCCCCTCCTAGGAGCCCCTCTGG + Exonic
1168293814 19:55369504-55369526 CGCCCTCCCAGGAGCCCCGCCGG + Intronic
1202647248 1_KI270706v1_random:153407-153429 GCCCCACCAGGGTGACCCTCAGG - Intergenic
1202706198 1_KI270713v1_random:26077-26099 AGGCTTCCAGGGAGACCCTCTGG - Intergenic
928083137 2:28327384-28327406 GGCCCTCCAAGGAGGCCCTCTGG - Exonic
932721033 2:74139151-74139173 CCCCCTCCAGGGAATCCCGCAGG + Intronic
934176243 2:89582339-89582361 CCCCCTCCAGGGATCCCTTCAGG + Intergenic
934182721 2:89641797-89641819 CCCCCTCCAGGATTACCCTCAGG + Intergenic
934286553 2:91656700-91656722 CCCCCTCCAGGGATCCCTTCAGG + Intergenic
934846473 2:97664030-97664052 CGCCCTCCAGAAAGCCCCGCGGG - Exonic
936042091 2:109157864-109157886 AGCTCTCCTAGGAGACCCTCAGG + Intronic
942558635 2:177198079-177198101 CGGCCTCCAGGGAAGCCTTCTGG - Intergenic
943064443 2:183071492-183071514 CGGCCTCCAGGGAAGCCCTCTGG + Intergenic
944763455 2:202840783-202840805 CAGCCTCCAGGGAAACTCTCTGG + Intronic
946320892 2:218953842-218953864 CGGCCTCCAGGGAAGCCCCCTGG + Intergenic
947708255 2:232293646-232293668 TGCCAGCCAGGGAGGCCCTCAGG - Intronic
949034970 2:241812120-241812142 GGCCCTCCACGCACACCCTCTGG - Intronic
1169072609 20:2742628-2742650 CACCCTCCATGGGGATCCTCAGG + Intronic
1172108002 20:32528051-32528073 CCCCCTCCAGGGAGCCCCCTCGG - Intronic
1172518487 20:35552367-35552389 CGGACTCCAGGGAGGCCCTAGGG - Intronic
1174225250 20:48993595-48993617 AGACCTCCAGGGAAACCCTAAGG - Intronic
1175673800 20:60930314-60930336 CTGCAGCCAGGGAGACCCTCTGG - Intergenic
1175881650 20:62262834-62262856 AGCCCTCCAGGGACACCCCAGGG - Intronic
1176184255 20:63769501-63769523 CTGCCTCCAGCGAGACCCTTGGG - Intronic
1176604622 21:8819367-8819389 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1179430065 21:41315824-41315846 AGCCCACCAGGGTGACCCACAGG + Intronic
1179488975 21:41728130-41728152 TGCCCTCCAGGAAAACCCACAGG + Intergenic
1180088853 21:45523765-45523787 CCCGTCCCAGGGAGACCCTCAGG - Intronic
1180091349 21:45535168-45535190 CCTCCTCCAGGGAGACCCCCCGG - Intronic
1180094999 21:45552366-45552388 TCCACTCCAGGGAGACCCACAGG + Intergenic
1180346911 22:11710972-11710994 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1180354660 22:11829062-11829084 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1180383591 22:12163270-12163292 GCCCCACCAGGGTGACCCTCAGG - Intergenic
1180878031 22:19184331-19184353 TGCTCTCCAGGGATACCCTGTGG + Intronic
1181924394 22:26346721-26346743 AGCCCTCCAGAGAGACCCATGGG - Intronic
1182587569 22:31353681-31353703 CAACCTCCAGGAAGACCTTCAGG - Intergenic
1183315517 22:37135017-37135039 AGCCCTCCAGGGAGAGCCCCGGG - Intronic
1183371317 22:37434041-37434063 CTCCCTCCAGGGAGATGCTGGGG + Intergenic
1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG + Intergenic
1184114445 22:42414231-42414253 CCCCCTCCAGGGCTCCCCTCTGG + Intronic
1184599260 22:45532897-45532919 TGCCCTACTGGGAGACCCCCAGG - Intronic
1184785678 22:46670547-46670569 CGCCCTCCACGGGGAGCCTGGGG + Intronic
1184959408 22:47918135-47918157 AGCGCACCAGGAAGACCCTCAGG + Intergenic
950549097 3:13655523-13655545 GGCGCGCCTGGGAGACCCTCAGG - Intergenic
952611555 3:35216154-35216176 AGGCCTCCAGGGAAGCCCTCTGG + Intergenic
952886034 3:38011409-38011431 CGTCCTCCAGGGAGTCTGTCTGG + Exonic
954583822 3:51717984-51718006 TGCCCTCCATGGAGGACCTCGGG + Intronic
955839492 3:63096824-63096846 CGGCCTCCAGGGAAGCCCTCTGG + Intergenic
957966168 3:87324241-87324263 CGGCCTCCAGGAAAGCCCTCTGG - Intergenic
961374044 3:126450637-126450659 CACCCTCCAGGGAGAGCAGCAGG - Intronic
961444747 3:126974141-126974163 CCCTCTCCATGGAGACCCCCTGG + Intergenic
961548463 3:127652540-127652562 AGCCCTCCAGGGAGAGGCTCGGG - Intronic
962198012 3:133380096-133380118 TGCCCTCGAGGGCGGCCCTCTGG - Exonic
962802618 3:138903171-138903193 TGTCCTTCAGGGAGGCCCTCAGG - Intergenic
962974401 3:140433527-140433549 CTCCCTGCAGGGAGACATTCTGG - Intronic
963607169 3:147421307-147421329 CGCCATCCAGCCAGAGCCTCCGG - Intronic
964979822 3:162665389-162665411 CGCCCACCAGAGGGACCCTTGGG - Intergenic
965605763 3:170496409-170496431 GGGCCTCCAGGGAAGCCCTCTGG - Intronic
967770055 3:193324893-193324915 GACCATCCAGGGAGACCCTCTGG - Exonic
967782891 3:193459110-193459132 GACCATCCAGGGAGACCCTCTGG - Exonic
967984053 3:195082345-195082367 AGCCCTCCAGGAAGACCACCAGG - Intronic
968025798 3:195442221-195442243 CGCCCTCCGGAGAGTCGCTCTGG + Intronic
968480515 4:831065-831087 TGCCCTCCAGGGACAGCCCCAGG - Intergenic
968883078 4:3311082-3311104 CGGCCTCCAGGGTGACCCCACGG - Intronic
969118175 4:4887546-4887568 CCCCCTCTAGGGAAACCCACTGG - Intergenic
969155397 4:5205526-5205548 AGCCAGCCAGGGAGGCCCTCAGG - Intronic
973373503 4:49271570-49271592 GCCCCACCAGGGTGACCCTCAGG - Intergenic
973387510 4:49523638-49523660 GCCCCACCAGGGTGACCCTCAGG + Intergenic
974069565 4:57111102-57111124 CGCCCTCCAGCAAGCCTCTCGGG + Intergenic
977928681 4:102729173-102729195 TGCCCTCCAGGGAAGCCCTCTGG + Intronic
979962403 4:127036590-127036612 CCCACTCCAGGCAGAACCTCAGG + Intergenic
984762625 4:183376369-183376391 TGCCCTCCAAGTGGACCCTCTGG + Intergenic
985486876 5:156767-156789 CGGCCTCCAGGGTGTCCCTGAGG - Exonic
990900500 5:60744007-60744029 CGGCCTCCAGGGAAGCCCTCTGG + Intergenic
992005583 5:72474312-72474334 AGCCCTCCAAGGAGACTTTCAGG - Intronic
996432917 5:123401343-123401365 CGGCCTCCAGGAAAGCCCTCTGG + Intronic
999271285 5:150297705-150297727 CGCCCTCCAGGGAGCCATGCTGG + Exonic
1000378074 5:160602753-160602775 CGCCCTTGAGAGAGTCCCTCTGG - Intronic
1003016139 6:2469028-2469050 GTCCCTCCAGGGAGTCACTCTGG + Intergenic
1005854498 6:29850526-29850548 AGCCCTCCAGGTTGTCCCTCCGG + Intergenic
1006386027 6:33731349-33731371 GTCCCTCCAGGGAGACCTCCTGG - Intronic
1013122236 6:107151155-107151177 GGCACTACTGGGAGACCCTCAGG + Intergenic
1017430180 6:154363207-154363229 CCCCCTCCCTGGAGACCCCCGGG + Intronic
1018289077 6:162272092-162272114 CGCCCCCTATGGAGCCCCTCTGG - Intronic
1018317252 6:162569254-162569276 TGGCCTCCAGGGAAGCCCTCTGG - Intronic
1018429102 6:163709619-163709641 CACCCTCCCCTGAGACCCTCAGG + Intergenic
1018694748 6:166382752-166382774 CAGCCTCCCGGGAGCCCCTCCGG + Intronic
1019289262 7:242397-242419 CCGCCTCCAGGAAGACCCTCTGG - Intronic
1019336439 7:485089-485111 GGTCCTCCAGTGAGAGCCTCGGG - Intergenic
1019422692 7:958420-958442 CCCCCTCCAGGGAAGCCCACTGG + Intronic
1019462513 7:1168326-1168348 AGGCTTGCAGGGAGACCCTCAGG + Intergenic
1019519100 7:1452639-1452661 GGCCCTGCAGGGAAACCCACTGG - Intronic
1019577187 7:1743256-1743278 CGTCCTGCCTGGAGACCCTCAGG + Intronic
1019893898 7:3968020-3968042 CGCCCTTCAGAGAGTGCCTCAGG + Intronic
1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG + Intronic
1023289644 7:38656171-38656193 CGGCCTCTAGGGAAGCCCTCTGG - Intergenic
1023938726 7:44756965-44756987 GGCCCTGCAGGGAGTCCCTCTGG + Exonic
1024620358 7:51151849-51151871 CGTCCTCCTGGGAGACCCCACGG + Intronic
1029440024 7:100582394-100582416 GGCCCTCCAGGGACACCAGCTGG + Exonic
1031207358 7:118777497-118777519 AGCTCTCCAGGGAGACCTTCTGG + Intergenic
1032037292 7:128530637-128530659 CGCCCTCCGGGGCGACGCGCGGG + Intergenic
1032388055 7:131538196-131538218 CTACCCCCAGGCAGACCCTCAGG + Intronic
1033170572 7:139080079-139080101 CGTCCTCCAGGGAAGCCCTGTGG + Exonic
1035022297 7:155806902-155806924 GACCCTCCAGGGGCACCCTCTGG + Intronic
1035724849 8:1817965-1817987 GGCGCTCCAGGGAGACCCTGGGG - Intergenic
1041781134 8:61579197-61579219 CGGCCTCCAGGGAAGCCCTCTGG - Intronic
1049395184 8:142396964-142396986 CTCTCTCCTGTGAGACCCTCGGG - Intronic
1049395207 8:142397058-142397080 CTCTCTCCTGTGAGACCCTCGGG - Intronic
1049395230 8:142397152-142397174 CTCTCTCCTGTGAGACCCTCGGG - Intronic
1049395253 8:142397246-142397268 CTCTCTCCTGTGAGACCCTCGGG - Intronic
1049441296 8:142610952-142610974 GGGTCTCCAGGGTGACCCTCTGG + Intergenic
1049577669 8:143397203-143397225 TGCCCTCCAGGGACTCCCACAGG + Intergenic
1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG + Intronic
1049966931 9:788340-788362 CACCCTCCAAGGAGCCCCTCTGG - Intergenic
1053292929 9:36893987-36894009 GGCTCTCCAGGGAGCCACTCTGG - Intronic
1056708611 9:88971949-88971971 CGACATCCAGAGAGACACTCTGG - Intergenic
1057943642 9:99306137-99306159 CGGCCTCCAGGGAAGCCCTCTGG - Intergenic
1059584371 9:115590359-115590381 CTCCCTCCAGGCAGACCTACTGG - Intergenic
1060763507 9:126275803-126275825 CGCCCTGCGGGAAGCCCCTCGGG + Intergenic
1061254896 9:129449307-129449329 CGCTCTGGAGCGAGACCCTCTGG - Intergenic
1061678469 9:132231181-132231203 CGCCCTCCTGGGGAACTCTCAGG - Intronic
1062031378 9:134363566-134363588 TGCCCTCCAGGGAGGCCCCAAGG + Intronic
1062047502 9:134431302-134431324 CTCCCTCCATGGAGACGCTGGGG - Intronic
1062303503 9:135888991-135889013 GGCCAGCAAGGGAGACCCTCGGG + Intronic
1203697212 Un_GL000214v1:109573-109595 GCCCCACCAGGGTGACCCTCAGG - Intergenic
1203552004 Un_KI270743v1:171456-171478 GCCCCACCAGGGTGACCCTCAGG + Intergenic
1189272156 X:39759381-39759403 CGCCCTCCTGAGACACCCTGGGG - Intergenic
1192349206 X:70342055-70342077 TATCCTCCAGGGAGCCCCTCTGG + Intronic
1194799433 X:98253615-98253637 CGCCCTCCAGGAATTCTCTCAGG - Intergenic
1197728280 X:129790930-129790952 CTCCCTGCAGGCAGACACTCTGG + Exonic
1200001934 X:153066606-153066628 TGTCCTCCAGGGAGAGCCTGGGG - Intergenic
1200005798 X:153083419-153083441 TGTCCTCCAGGGAGAGCCTGGGG + Intergenic