ID: 1020068150

View in Genome Browser
Species Human (GRCh38)
Location 7:5205558-5205580
Sequence CAGTGAGCCACCTCCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020068150 Original CRISPR CAGTGAGCCACCTCCTCCTG TGG (reversed) Intronic
901274079 1:7977157-7977179 CAGTGATCCTCCCCCTCCTTTGG + Intronic
902059543 1:13630613-13630635 CAGTGGGCCACCACGTCCCGCGG - Intergenic
902368508 1:15991919-15991941 CAGTGACATACCCCCTCCTGTGG + Intergenic
902599689 1:17532454-17532476 CAGGGGGCCACCTACTCCTCAGG - Intergenic
902614490 1:17616372-17616394 CAGTGTGCCTCCCCCTCCTCTGG + Intronic
903170117 1:21547447-21547469 CCCTCAGCCTCCTCCTCCTGGGG + Intronic
904458058 1:30659008-30659030 CTCTGTGCCCCCTCCTCCTGGGG - Intergenic
905649135 1:39644928-39644950 CAGTGAGCAAATTCTTCCTGAGG - Intergenic
907334295 1:53690260-53690282 CAGTGAGCCATCCCTGCCTGTGG - Intronic
907762494 1:57375165-57375187 GAGACAGCCACCTGCTCCTGTGG - Intronic
909515327 1:76501030-76501052 CAGTCTTCCTCCTCCTCCTGGGG - Intronic
912153678 1:106889178-106889200 CAGTGTGCCTTCTCCTCCAGAGG - Intergenic
912845538 1:113071724-113071746 CAGTGAGCCACTTACTGCGGAGG + Intergenic
912960500 1:114191483-114191505 CAGCGAGTCAGCTCTTCCTGGGG - Intergenic
912962920 1:114211844-114211866 CTGTGTGCCATCTCCTCATGAGG - Intergenic
914956488 1:152167322-152167344 CAGTGGGCCATCTGCTCCTCTGG - Intergenic
916457234 1:164983282-164983304 CAGAAAGCCTCCTCCTCCTTAGG + Intergenic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
920373232 1:205492643-205492665 CAGGGGGCCAGCTCCTCCAGGGG - Intergenic
920464662 1:206172261-206172283 AAGTGAGCAACCTCCTCCGCTGG + Intergenic
922474400 1:225897305-225897327 CAGTGAACCACTTCCTGTTGGGG + Intronic
923006705 1:230055703-230055725 CCATGAATCACCTCCTCCTGAGG - Intergenic
923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG + Intergenic
923254501 1:232209766-232209788 CAGTGATTCACCTCCTTCAGTGG + Intergenic
1062981226 10:1724625-1724647 CAGTGAGCCACAGCCTGGTGGGG + Intronic
1063430979 10:5988039-5988061 CATTAAGCCACTTCCTCTTGGGG - Intergenic
1064181598 10:13121171-13121193 CTGTGAGCCAGCTCCTGCTGTGG + Intronic
1065746279 10:28845401-28845423 CAGTGAGTCAGCTTCTCGTGGGG + Intergenic
1067163225 10:43844496-43844518 CACAGGGCCCCCTCCTCCTGTGG - Intergenic
1068120237 10:52777104-52777126 CAGTGAGCAACCTCCTTTTGGGG - Intergenic
1068292013 10:55015699-55015721 CAGGGAACAACCTTCTCCTGTGG - Intronic
1069327748 10:67251927-67251949 GTGTGAGCCACCACCTCCTCAGG - Intronic
1069788861 10:71006626-71006648 CAGTGACCCTCCCTCTCCTGTGG + Intergenic
1072833279 10:98682540-98682562 CAGTCAGCCACCTGATCATGAGG - Intronic
1073407665 10:103312007-103312029 CACTGCACCTCCTCCTCCTGGGG - Intronic
1074853501 10:117457012-117457034 CTGAGAGCAGCCTCCTCCTGTGG + Intergenic
1076794910 10:132793723-132793745 CAGTGGCCCACCTGCTCCTGGGG - Intergenic
1077050318 11:563485-563507 CTGTGCCCCACCTCCCCCTGGGG + Intronic
1077359635 11:2135057-2135079 CCGTGAGGCTCCTGCTCCTGAGG - Intronic
1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG + Intergenic
1080326252 11:31076857-31076879 CTGTGATCTACCTCCTCCTGGGG - Intronic
1083732550 11:64660651-64660673 CCCTGTGCCACCTCCTCCTAGGG - Intronic
1084207292 11:67603073-67603095 TGGTGAGCCAGCTCCTCATGGGG + Exonic
1084420253 11:69057116-69057138 GCGTGAGCCACCGCCTTCTGGGG + Intronic
1085262807 11:75217865-75217887 CAGTGAGCTCCCTATTCCTGAGG + Intergenic
1089438142 11:118489163-118489185 CAGTGAGCCACTCCAGCCTGTGG + Intronic
1090631810 11:128656184-128656206 ATGTGAGCCACCACGTCCTGCGG + Intergenic
1094103911 12:26788570-26788592 CAGTGTGCCTCTTCCACCTGGGG + Intronic
1095052203 12:37564529-37564551 GTGTGAGCCACCTCACCCTGTGG - Intergenic
1095272697 12:40238615-40238637 CTGTGACCCACTTCCTCCTAAGG - Intronic
1097156456 12:57015700-57015722 CCAGGAACCACCTCCTCCTGTGG + Exonic
1098885584 12:75957234-75957256 CAGTCAGCCACCTCTATCTGCGG - Intergenic
1099082980 12:78209866-78209888 CATTCAGTCACCTCCTCCCGAGG + Intronic
1101320103 12:103665958-103665980 CAGGGAGGCACCTGCCCCTGAGG - Intronic
1101725081 12:107382190-107382212 TAGTAAGTCACCTCCTCCAGGGG - Intronic
1103144060 12:118578944-118578966 CCATGTGCCACCTCCTCCTCTGG + Intergenic
1103579342 12:121902810-121902832 AACGGGGCCACCTCCTCCTGGGG - Intronic
1103873425 12:124107580-124107602 CTGTTGGCCACCTCCTTCTGGGG + Intronic
1108757378 13:53520310-53520332 CAGTGACCCACCTCCTGCAGAGG - Intergenic
1109484534 13:63001710-63001732 CAGCAACCCACCTCCTTCTGAGG - Intergenic
1109506782 13:63312118-63312140 CGGTGAGCCTCCTCTGCCTGTGG + Intergenic
1112666935 13:101585708-101585730 GTGTGAGCCACCTCCCCCGGCGG + Intronic
1113569811 13:111345869-111345891 CTGTGTGCCGCTTCCTCCTGAGG - Intergenic
1113639110 13:111944487-111944509 CAGCCAGCCACCTCCTCCCCAGG - Intergenic
1113798141 13:113070761-113070783 GAGTGAGCCACCGGCACCTGGGG - Intronic
1114083246 14:19219487-19219509 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1115053173 14:29089773-29089795 CAGGGAGCTATCTCCTCCAGGGG - Intergenic
1118340632 14:64893993-64894015 CCATGTGCCACCTCCTCCTCTGG + Intergenic
1121869863 14:97397188-97397210 GAGTGAGCTACCACCTTCTGAGG - Intergenic
1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG + Intronic
1122860430 14:104580015-104580037 AAGTGAGCCCCCTCTCCCTGGGG - Intronic
1202894868 14_GL000194v1_random:1257-1279 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1125221888 15:37347329-37347351 CAGAGAGCCACCTACTTATGTGG + Intergenic
1127977770 15:64010950-64010972 GAGTCAGCCACCTCCACATGGGG - Intronic
1129572270 15:76700450-76700472 TAGTTAGCCACCTCTTCCTCAGG + Intronic
1129835464 15:78702728-78702750 GGGTGAGGCTCCTCCTCCTGTGG - Intronic
1133201721 16:4207838-4207860 CACAGAGTCACCTCCACCTGGGG - Intronic
1133434252 16:5765727-5765749 CAGTGAAGCACCTCAGCCTGGGG + Intergenic
1134233208 16:12445435-12445457 CAGGGAGCCCCAGCCTCCTGGGG - Intronic
1134841440 16:17405148-17405170 AAGGGAGCCAACTCCTGCTGAGG + Intronic
1136392009 16:29971402-29971424 CACAGAGCCAGCTCCTCCTAGGG - Exonic
1138527032 16:57614773-57614795 TACTGAGTCACCTCCTCCGGGGG - Intronic
1140357028 16:74315223-74315245 CATTCAGCCACCTGGTCCTGTGG + Intergenic
1141719064 16:85745250-85745272 CAGAGGTCCACCCCCTCCTGAGG + Intronic
1142290597 16:89192202-89192224 CAGTGAGCCACGCGCGCCTGCGG + Exonic
1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG + Intronic
1142933561 17:3308881-3308903 CAGTGATCCACCTCAACCTCTGG - Intergenic
1143885795 17:10063929-10063951 TAGTGAGTCACCTCCTCCAAAGG + Intronic
1145845012 17:28031018-28031040 CACTGAGCAACCTTCTGCTGAGG + Intergenic
1146292873 17:31623742-31623764 CAGTCAGCCACATAATCCTGAGG - Intergenic
1146518881 17:33510896-33510918 CAGAGACCCAGCTCCTCCTGGGG + Intronic
1146547996 17:33755783-33755805 CAGTGGGTCACCTCTTCCTTTGG - Intronic
1146803246 17:35844357-35844379 GGCTGACCCACCTCCTCCTGAGG - Exonic
1147266863 17:39239761-39239783 CTGTGCGCCACGCCCTCCTGTGG + Intergenic
1149386076 17:56144628-56144650 CACTCACTCACCTCCTCCTGAGG - Intronic
1151245611 17:72792297-72792319 AAGCCAGCCACATCCTCCTGCGG - Intronic
1151780329 17:76240846-76240868 CAGGGAGCCGCCCCCTCCCGCGG + Intergenic
1157113931 18:44845670-44845692 CAGTGAGCCAGCTGCCCATGGGG - Intronic
1157397561 18:47355565-47355587 CTCTGGGCCACCTCCTCATGTGG + Intergenic
1158435673 18:57434478-57434500 AAGTGAGCAAACTTCTCCTGGGG - Intergenic
1160760037 19:779213-779235 CAGTGTGGCTTCTCCTCCTGTGG - Intergenic
1163862054 19:19747807-19747829 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1165096067 19:33410575-33410597 CAATGTGCCAGCTCCTCCAGCGG - Intronic
1166379693 19:42349493-42349515 CAGCGCCCCACCTCCTCCTGGGG - Exonic
1166788374 19:45382943-45382965 CAGTGGGCCACCCACTCCCGAGG + Intronic
1167695977 19:51015832-51015854 CCCTCAGCCCCCTCCTCCTGAGG + Intronic
1168354929 19:55695027-55695049 CCGTGAGGCACCTCCTCTGGTGG - Intronic
1168584464 19:57581952-57581974 AAATGACCCACCTACTCCTGAGG - Intronic
925367885 2:3323600-3323622 ACGTGAGCAGCCTCCTCCTGAGG + Intronic
925684729 2:6459059-6459081 TACAGAGCCACCTCCACCTGAGG + Intergenic
932907270 2:75767523-75767545 CAGGGAGGCTCCTCCTCCTTTGG + Intergenic
935385960 2:102500515-102500537 CACTGTGCAACCTCCTCGTGTGG + Intronic
936227421 2:110669306-110669328 ATGTCAGCCACCTGCTCCTGTGG - Intronic
938208314 2:129442568-129442590 CGGTGAGTCAGCTCCTCCTGGGG - Intergenic
938499155 2:131821521-131821543 GGGTGAGCCAGGTCCTCCTGAGG + Intergenic
940781677 2:157940095-157940117 CACAGATACACCTCCTCCTGTGG + Intronic
941996069 2:171603174-171603196 TCCTGAGCCACCTCCTCCAGAGG + Intergenic
947300493 2:228683737-228683759 CAATAAGCCACCTCTTCTTGAGG + Intergenic
1169823846 20:9744118-9744140 CAGGGACCCACTTCCTCCAGAGG - Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171420775 20:25016043-25016065 TATTTAGCCACCTACTCCTGAGG - Intronic
1172356689 20:34285244-34285266 CAGGGAGCCACTCCCTACTGTGG + Intronic
1173382776 20:42560972-42560994 CTGTGGGCTACTTCCTCCTGGGG + Intronic
1174332512 20:49831328-49831350 CACACAGCCACCTCCTCGTGTGG - Intronic
1175010220 20:55727338-55727360 CAAGGTGCCACCTCCTCCTTTGG + Intergenic
1175342558 20:58243021-58243043 CAGTGACCCCCTTCCTCCTGTGG - Intergenic
1175445673 20:59017979-59018001 CGGTGAGCAACCACCTCTTGAGG - Intergenic
1175453967 20:59095699-59095721 CAGTTAGCCACCTCTTACTCTGG + Intergenic
1175499635 20:59440754-59440776 CTTTGAGCCACCTGCTCATGAGG - Intergenic
1175791647 20:61743884-61743906 CAGACAGTCACCTCCTCCTCGGG + Intronic
1176614565 21:9017244-9017266 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1177557788 21:22714690-22714712 CAATGAACCAACTCCCCCTGGGG - Intergenic
1180087903 21:45516281-45516303 CACTGTGGCACCTGCTCCTGGGG - Intronic
1180294727 22:10873780-10873802 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1180497533 22:15903194-15903216 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1182133635 22:27879484-27879506 CAGGAACCCACCTCCCCCTGAGG - Intronic
1182214503 22:28704611-28704633 CAGTGAGCCACCACGCCCGGTGG + Intronic
1182429629 22:30292096-30292118 CCTTCAGCCCCCTCCTCCTGGGG - Exonic
1182760122 22:32715983-32716005 CTGACAGCCACCTCCTCCAGAGG - Intronic
1183317304 22:37143729-37143751 GAGTTACCCACCTCCTCCTCTGG - Intronic
1183648907 22:39142504-39142526 CAGGGAGCACCCTCCTGCTGGGG + Intronic
1183730327 22:39614837-39614859 AAGACAGCCACCTCCTCCTGGGG + Intronic
1184401606 22:44277732-44277754 CAGTGATCCACTTCCACCTCAGG - Intronic
1184470361 22:44692407-44692429 CAGGGATCCTCCTCCTCCCGGGG + Intronic
1185061271 22:48608068-48608090 CAGTGAGCCAGCCCCTCCCACGG + Intronic
1185421755 22:50738792-50738814 CAGTGTGCCCCCTACACCTGTGG + Intronic
949180070 3:1118242-1118264 CAGTGAGTCACCGAGTCCTGTGG - Intronic
950582193 3:13869894-13869916 CTCTGAGCCACCGTCTCCTGAGG + Intronic
950767504 3:15284119-15284141 CAGTGAACCAGCTGCTCCTCTGG + Intronic
954636835 3:52075547-52075569 CGTGGAGCCACCTCCTCCAGAGG + Exonic
954701264 3:52452085-52452107 CGGTGAGCCCCCTCCTCCCCAGG - Exonic
955886100 3:63600404-63600426 CATTGTCCCACCTCCTGCTGAGG - Intronic
956468394 3:69541430-69541452 GAGAGAGAGACCTCCTCCTGCGG + Intronic
957511611 3:81195691-81195713 TGGTGAGTCAGCTCCTCCTGGGG + Intergenic
959297461 3:104555159-104555181 CACTGAGCCAACTACTCCTATGG - Intergenic
960323377 3:116264989-116265011 CTGTGAGCAGCCTCATCCTGAGG + Intronic
961548472 3:127652591-127652613 CAGTGCCCCAGCTCTTCCTGAGG + Intronic
961742121 3:129039554-129039576 CTGTGGACCACCTCCCCCTGAGG - Intronic
961746110 3:129064388-129064410 CAGGGAGTCACCGTCTCCTGGGG - Intergenic
962566790 3:136668754-136668776 CATTGAGCCACATTCTCCTCAGG - Intronic
964425985 3:156554692-156554714 TAGTTAACCACCTTCTCCTGGGG + Intronic
966210783 3:177451164-177451186 CAGTAAGCCACGTTCTTCTGAGG + Intergenic
966806235 3:183809985-183810007 AAGTGAGCCAGGGCCTCCTGTGG + Intronic
969355632 4:6623775-6623797 AAGAGAGCCACTTCCCCCTGCGG + Intergenic
969635856 4:8369262-8369284 TGGTGAGCCCCCACCTCCTGGGG + Intronic
973592134 4:52453237-52453259 CAGAGAGCCTCCTCCTCCAAAGG - Intergenic
977446080 4:97134649-97134671 TAATCAGCCACCTCCTGCTGAGG + Intergenic
978385553 4:108172768-108172790 CACAGGGCCGCCTCCTCCTGCGG + Intergenic
979862137 4:125707346-125707368 GAGTGGCCCAACTCCTCCTGGGG - Intergenic
982118162 4:152115052-152115074 CAATGTACCACCTCCTGCTGTGG - Intergenic
985489286 5:169828-169850 CTGTGAGCCTCCGCCTCCAGGGG - Intronic
985971450 5:3381489-3381511 CACTGAGACACCTCTTCATGAGG - Intergenic
985971463 5:3381557-3381579 CAGTGAGACACCTCTTCATGAGG - Intergenic
986241681 5:5965533-5965555 CAGTGAGGCACCACAGCCTGAGG + Intergenic
987164016 5:15174593-15174615 GAGTGAGGCTCCTCTTCCTGTGG + Intergenic
988370040 5:30356888-30356910 TAATGAGCCACCTACTCCTCTGG + Intergenic
989103854 5:37842583-37842605 CATTAACCCACCTCCTTCTGAGG - Intergenic
989575411 5:42983152-42983174 CGGTGAGCCAGCTCCTCATGGGG + Intergenic
990468139 5:56088449-56088471 CAGTGAGGCACCCCAGCCTGGGG + Intergenic
990886694 5:60602441-60602463 CAGTGAACTGCCTCCTTCTGAGG - Intronic
993287881 5:86023399-86023421 GCTTGAGCCACCTCGTCCTGCGG + Intergenic
995945787 5:117644379-117644401 CAGGGAGCCACCTCTTCTTCTGG - Intergenic
998028755 5:138844958-138844980 CAGTGAGCCACCTACTAATGGGG - Intronic
999231639 5:150065390-150065412 CTGTGCGCCTCCTCCTCCAGGGG + Intronic
999588798 5:153120844-153120866 AAATGTGCCACCACCTCCTGTGG - Intergenic
999769781 5:154766663-154766685 CAGTCGGCCCCCTTCTCCTGGGG + Intronic
1000480382 5:161766528-161766550 CAGTGAATGACCTGCTCCTGAGG + Intergenic
1003004555 6:2368965-2368987 CAGTGAGCAAGACCCTCCTGAGG - Intergenic
1003455077 6:6274739-6274761 CTGTTAGCCACTTCCTCCTCTGG - Intronic
1006024470 6:31138375-31138397 CAGACAGGCTCCTCCTCCTGGGG - Intronic
1006046811 6:31305850-31305872 CTGTGGGTCACCTCCTCCTGTGG - Intronic
1006113798 6:31764469-31764491 CGCTGAGCCATCTCCTCCTTTGG - Exonic
1007594552 6:43043466-43043488 CTGTGAGGCACCCCCTCCTGTGG - Exonic
1013300278 6:108798823-108798845 CACTGAGCCCGCTCCTGCTGCGG - Intergenic
1016920240 6:149285450-149285472 AAGTGATCTACCTCCTCCTCAGG + Intronic
1018886783 6:167945320-167945342 CATGGAGCCATCACCTCCTGTGG + Intronic
1018978640 6:168584233-168584255 CTGTGAGATAGCTCCTCCTGCGG + Intronic
1020068150 7:5205558-5205580 CAGTGAGCCACCTCCTCCTGTGG - Intronic
1022071742 7:26922693-26922715 CAGTGATCCAGGTCTTCCTGTGG - Intronic
1025035977 7:55592679-55592701 ACATGAGCCACCTTCTCCTGGGG - Intergenic
1029365176 7:100112059-100112081 CCCTGAGACGCCTCCTCCTGGGG - Intronic
1030627562 7:111860438-111860460 CAGCAAGCCACATCCTGCTGCGG + Intronic
1035654306 8:1294005-1294027 CAGCGAGCCACCTTCACGTGTGG - Intergenic
1036097715 8:5741892-5741914 CAGTGAGAAACCTCCCCGTGGGG + Intergenic
1038532807 8:28332163-28332185 CAGGCAGCCACATCCTCCGGGGG - Intronic
1040409454 8:47139457-47139479 CAGTGAGCTACCTCAGCCTCTGG + Intergenic
1045508696 8:102796703-102796725 GCGTGAACCTCCTCCTCCTGGGG + Intergenic
1049106453 8:140616759-140616781 CAGTGAGCTCTCTCCCCCTGAGG - Intronic
1053285742 9:36848556-36848578 CACGGAGCCTCCTCCTCCTCAGG + Intronic
1053513704 9:38711304-38711326 CAGTGAGTCCCCTGCACCTGTGG - Intergenic
1053647624 9:40132326-40132348 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1053758107 9:41331517-41331539 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1054328601 9:63730280-63730302 GGGTGAGCCAGGTCCTCCTGGGG - Intergenic
1054536955 9:66243844-66243866 GGGTGAGCCAGGTCCTCCTGGGG + Intergenic
1056845337 9:90032589-90032611 CAGGGAGCAACGTCCTCATGTGG - Intergenic
1056992037 9:91421591-91421613 CAGTGCGCCGCTCCCTCCTGCGG - Intronic
1057809009 9:98243440-98243462 CTGTGAGCCACCTCGTCCAGTGG + Intronic
1058824071 9:108759307-108759329 AAGAGAGCCAGCTCCTCCTGGGG - Intergenic
1059362562 9:113756641-113756663 CAGTAAGACACCTGCTACTGGGG - Intergenic
1060601195 9:124878976-124878998 CAGTGACTAACCTCCTCCTCTGG - Exonic
1060793815 9:126501915-126501937 CAGTGCTCCGCCTCCTGCTGGGG + Intronic
1062025038 9:134336291-134336313 GTGTGACCCACCTTCTCCTGAGG + Intronic
1062093159 9:134689157-134689179 CTGGCAGCCACCTCCTCCCGTGG + Intronic
1062395668 9:136351675-136351697 CAGGGAGCCCCCACCTGCTGCGG + Intronic
1062396200 9:136353822-136353844 CAGGAGGCCACATCCTCCTGGGG + Intronic
1188190532 X:27166713-27166735 CAGTTAGCCCTCTCCTCTTGAGG - Intergenic
1189724492 X:43954806-43954828 CAGTTCCCCACCTGCTCCTGTGG + Intronic
1191788866 X:64946482-64946504 CAGTCACCCACCTCCTGCTTTGG + Intronic
1192708005 X:73547815-73547837 AATTGAACCACCTGCTCCTGAGG + Intergenic
1199619117 X:149683501-149683523 CCGTGAGCCAGCTCCTCCTGGGG + Intergenic
1199635835 X:149810632-149810654 CAGAGAGGCATCTCCTCCTGGGG + Intergenic
1199643837 X:149886223-149886245 CAGAGAGGCATCTCCTCCTGGGG + Intergenic
1200960486 Y:8991726-8991748 TGGTGACCCACCTCCACCTGGGG - Intergenic