ID: 1020068612

View in Genome Browser
Species Human (GRCh38)
Location 7:5210326-5210348
Sequence CTCCTCGTTCCCAGACTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020068605_1020068612 27 Left 1020068605 7:5210276-5210298 CCATTCTTCCTACACATCTCCAT 0: 1
1: 0
2: 2
3: 46
4: 427
Right 1020068612 7:5210326-5210348 CTCCTCGTTCCCAGACTCAGGGG No data
1020068608_1020068612 8 Left 1020068608 7:5210295-5210317 CCATCAAAATATGTCAAGGTCGC 0: 1
1: 0
2: 0
3: 12
4: 58
Right 1020068612 7:5210326-5210348 CTCCTCGTTCCCAGACTCAGGGG No data
1020068606_1020068612 19 Left 1020068606 7:5210284-5210306 CCTACACATCTCCATCAAAATAT 0: 1
1: 0
2: 3
3: 23
4: 245
Right 1020068612 7:5210326-5210348 CTCCTCGTTCCCAGACTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020068612 Original CRISPR CTCCTCGTTCCCAGACTCAG GGG Intronic
No off target data available for this crispr