ID: 1020070329

View in Genome Browser
Species Human (GRCh38)
Location 7:5223190-5223212
Sequence CAGGACTGTCCCTCCCTCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020070320_1020070329 22 Left 1020070320 7:5223145-5223167 CCCTCATCGGTGCTTACATGCCT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 226
1020070324_1020070329 2 Left 1020070324 7:5223165-5223187 CCTCCTGTGGCGCCTGCTTTGGA 0: 1
1: 0
2: 1
3: 16
4: 129
Right 1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 226
1020070328_1020070329 -10 Left 1020070328 7:5223177-5223199 CCTGCTTTGGAGGCAGGACTGTC 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 226
1020070326_1020070329 -1 Left 1020070326 7:5223168-5223190 CCTGTGGCGCCTGCTTTGGAGGC 0: 1
1: 0
2: 1
3: 14
4: 129
Right 1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 226
1020070321_1020070329 21 Left 1020070321 7:5223146-5223168 CCTCATCGGTGCTTACATGCCTC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG 0: 1
1: 0
2: 1
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020070329 Original CRISPR CAGGACTGTCCCTCCCTCGT CGG Intronic
900910665 1:5594815-5594837 CAGCTCTGCCCCTCCCTGGTGGG - Intergenic
900972109 1:5997393-5997415 AAGGAGTGTCCCTCCCTCAGAGG - Intronic
902875982 1:19341206-19341228 CAGGACTGTCCCTGGCTCTGCGG + Intronic
904384128 1:30130504-30130526 CAGGCCTCCCCCTCCCTCCTGGG + Intergenic
904443871 1:30551730-30551752 CAGGACTGTGACTCCCTCTTTGG + Intergenic
904500605 1:30910598-30910620 CTGGGCTCTCCCTCCCTCCTGGG - Intergenic
905546190 1:38802156-38802178 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
907153048 1:52306673-52306695 CAGGGCTGTGACTCCCTCTTTGG + Intronic
907369535 1:53991993-53992015 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
907878246 1:58516882-58516904 CAGGACTTTCTCTCCCTTTTAGG + Intronic
908395321 1:63720047-63720069 CAGGACTGACCTTCCCACCTTGG - Intergenic
909282395 1:73771435-73771457 CAGGACTGTGACTCCCTCTTTGG + Intergenic
912822800 1:112881190-112881212 CAGGACGGTCACTCCCTAGAAGG - Intergenic
915275217 1:154783779-154783801 CAGCACTGTCCCTGTCTCATGGG - Intronic
920379663 1:205528189-205528211 CAGGCCTGTCCTCCCCTCCTCGG - Intronic
920804334 1:209219064-209219086 CAGGACTGTGTCTGGCTCGTGGG + Intergenic
922041596 1:221903332-221903354 CAGGGCTGTGACTCCCTCATTGG - Intergenic
922423727 1:225475631-225475653 CAGGACTGCCCCTCCATGGAGGG + Intergenic
923391442 1:233516681-233516703 CAGGTCTGTGACTCCCTCTTTGG + Intergenic
1062769966 10:91680-91702 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1067341945 10:45412738-45412760 GATGACTGTGGCTCCCTCGTGGG - Intronic
1067479414 10:46585296-46585318 CAAGCCTGTCCCTCCCTGTTGGG - Intronic
1067615324 10:47756502-47756524 CAAGCCTGTCCCTCCCTGTTGGG + Intergenic
1068279807 10:54854256-54854278 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1069156343 10:65035230-65035252 CAGGACTGTGACACCCTCTTTGG + Intergenic
1069249022 10:66245315-66245337 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1069593046 10:69653643-69653665 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1071630726 10:87216453-87216475 CAAGCCTGTCCCTCCCTGTTGGG + Intergenic
1071819266 10:89264043-89264065 CAGGGCTGTGCCACCCTCTTTGG - Intronic
1073248314 10:102106933-102106955 GAGGCCTGTTCCTCCCTGGTGGG + Intergenic
1073930313 10:108567155-108567177 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1074875684 10:117611438-117611460 GGGGACTGTCCCGCCCTCCTGGG + Intergenic
1074892968 10:117750605-117750627 CATGACTGTACCTCCTTCCTAGG + Intergenic
1074991463 10:118712349-118712371 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1076655081 10:132018690-132018712 CAGGGCTGTAACTCCCTCTTTGG - Intergenic
1076816478 10:132917470-132917492 CAGGCCTGTTCCTCCCACGCAGG - Intronic
1076979670 11:197801-197823 CAGGCCTGCCCCTCCCTGCTGGG + Intronic
1077116613 11:888008-888030 CAGGACTGCCCCTTCCTGCTTGG - Intronic
1078345460 11:10544191-10544213 CAGGACTGTAACACCCTCTTGGG - Intergenic
1079472219 11:20789468-20789490 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1081528161 11:43941342-43941364 CAGGACTGTACCTTTCTTGTTGG + Intronic
1081944508 11:46977999-46978021 TAGGACTGTGCCTCCCAGGTGGG - Intronic
1081957793 11:47108672-47108694 CTGAACTGTCCCACCCTTGTGGG - Intronic
1082009622 11:47441477-47441499 CAGGAATGTCCTGGCCTCGTAGG + Intronic
1083876442 11:65526474-65526496 GAGGAGTGTCCCTCACTCCTGGG - Intronic
1083896226 11:65621060-65621082 CAGCACTGCCCGTCCCTCCTGGG - Intronic
1084268115 11:68015243-68015265 CAGGGCTGCCCCTCCTTCATGGG - Intronic
1084566058 11:69929839-69929861 CAGGACTGTCCCTTCCTGGCTGG - Intergenic
1084756909 11:71245698-71245720 CTGGACTTTCCCTCCCTCGAGGG - Intronic
1085100698 11:73797466-73797488 CAGGGCTGTGACTCCCTCCTTGG + Intronic
1085629428 11:78101484-78101506 CAGGCCTGTGCCACCCTGGTCGG - Intronic
1085782729 11:79424123-79424145 CAAGATTGTCCGTCCCTGGTTGG - Intronic
1089186439 11:116618705-116618727 AAGCACTGTCCTTCCCTCCTAGG + Intergenic
1090124802 11:124074893-124074915 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1090514539 11:127411578-127411600 CAAGGCTGTGCCTCCCTCCTTGG - Intergenic
1093492914 12:19725462-19725484 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1094018165 12:25885529-25885551 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1095310430 12:40692172-40692194 CTGGACCCTCCCTCCCTCTTGGG + Intergenic
1096562085 12:52443009-52443031 CAGCACTCTCCCTCCCTCCTGGG + Intergenic
1097140719 12:56900567-56900589 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1097298887 12:57997459-57997481 CAGGACTGTGACTCCCTCTTTGG - Intergenic
1098597754 12:72294084-72294106 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1098802907 12:74984990-74985012 CAGGACTGTGACACCCTCTTTGG - Intergenic
1102689840 12:114751716-114751738 CAGGCCTATTCCTCCCTCATGGG + Intergenic
1104255201 12:127130122-127130144 CAGGACTGGCCATCCTTGGTTGG - Intergenic
1104374118 12:128249104-128249126 CATGACTGCCCCTCCCTTGCAGG - Intergenic
1105041963 12:132967707-132967729 CAGGGCTGTGACTCCCTCTTAGG + Intergenic
1108240239 13:48456908-48456930 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1108352756 13:49602230-49602252 CAGGACAGTCCCTCCCATGAAGG + Intergenic
1110670161 13:78168681-78168703 CAGGACTGTGACTCCCTCTTTGG - Intergenic
1111202742 13:84961468-84961490 CAGGACTGTGACACCCTCTTTGG - Intergenic
1111842870 13:93472606-93472628 CAGGCCTGTGACTCCCTCTTTGG - Intronic
1114281137 14:21193163-21193185 CAGGACTGTGACTCCCTCTTTGG + Intergenic
1116083308 14:40203926-40203948 CAGGACTGTGACACCCTCTTTGG - Intergenic
1117252811 14:53953136-53953158 CAGCACTGTCGCTCCCTTCTTGG - Intronic
1121824562 14:96999964-96999986 CAGGACTGTGACTTCCTCTTTGG - Intergenic
1121882683 14:97514817-97514839 CAGGCCTGCCCCTCCATCCTGGG - Intergenic
1124484294 15:30101794-30101816 CTGGACTGTGCCTCCCTCCCTGG + Intergenic
1124519288 15:30395430-30395452 CTGGACTGTGCCTCCCTCCCTGG - Intergenic
1124539367 15:30570791-30570813 CTGGACTGTGCCTCCCTCCCTGG + Intergenic
1124759283 15:32436781-32436803 CTGGACTGTGCCTCCCTCCCTGG - Intergenic
1126316395 15:47374496-47374518 CAGGTCTCTTCCTCCCTCCTTGG + Intronic
1126888191 15:53175077-53175099 CAGGACAGTGCCTCCCACGATGG - Intergenic
1128481865 15:68046429-68046451 CAGGGCTGTCACTCCCTCCTTGG + Intergenic
1128847954 15:70917982-70918004 CAGGGCTGTGACTCCCTCTTTGG + Intronic
1129591166 15:76916298-76916320 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1130620012 15:85452996-85453018 CAGCACTGACCCTCCATCCTGGG - Intronic
1132028365 15:98421255-98421277 CACCACAGTCCCTCCCTAGTAGG + Intergenic
1132673026 16:1109537-1109559 CAGGACAGTTCCTCCCTCCTGGG + Intergenic
1133164917 16:3939412-3939434 CACGACTGTCCATCCCTCCCAGG - Intergenic
1134078345 16:11308048-11308070 CAGGACTGGGACTCCCTCTTTGG - Intronic
1134254664 16:12601299-12601321 CAGGACTGTAACACCCTCTTTGG + Intergenic
1134452366 16:14371327-14371349 CAGGAGTGACCCTCCCTAATGGG + Intergenic
1136037528 16:27551239-27551261 CAGCACTGTCCCTCACTTCTCGG + Intronic
1136924738 16:34361746-34361768 CAGGAATGACCCTCCCTCCCAGG + Intergenic
1136979835 16:35050060-35050082 CAGGAATGACCCTCCCTCCCAGG - Intergenic
1138016823 16:53435415-53435437 CAGGACTGTGGCTACCTCGAGGG + Intronic
1139138611 16:64234132-64234154 CAGGGCTGTGCCACCCTCTTTGG + Intergenic
1141171735 16:81696012-81696034 CAGCACTGACTCTCCCTCTTGGG - Intronic
1142482577 17:227985-228007 CAGGACTGTCTGTCCCTGCTGGG + Intronic
1143273745 17:5694623-5694645 CAGGCCCCTCCCTCTCTCGTTGG - Intergenic
1143498400 17:7325217-7325239 CAGGGCAGTGCGTCCCTCGTGGG + Exonic
1144714586 17:17425083-17425105 CAGGGCTGTGCCTCTCTCTTTGG + Intergenic
1145791753 17:27631984-27632006 GAGGACTGTCCCTGCAGCGTGGG + Intronic
1146359266 17:32160565-32160587 CAGGGCTGTGACTCCCTCTTTGG + Intronic
1147425903 17:40345742-40345764 CCGGGCAGTCCCTCCCCCGTTGG + Intronic
1148386202 17:47236920-47236942 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1148684086 17:49491036-49491058 CAGTACTGTACTTCCCTCATGGG + Intergenic
1149563036 17:57622919-57622941 CAGGACCTTCCCTCCCTTGCAGG - Intronic
1152253017 17:79221544-79221566 CAGGACTTTCCTTCCCTGGAGGG + Intronic
1157546205 18:48548280-48548302 CAGGCCTGTCCCACACTCTTGGG + Intronic
1158023302 18:52869017-52869039 CAGGGCTGTATCTCCCTCTTTGG - Intronic
1159519010 18:69495202-69495224 CAAGACTGTGACTCCCTCTTTGG - Intronic
1159957672 18:74531226-74531248 CAGATCTTTCCCTCCCTCCTGGG + Intergenic
1160678315 19:401981-402003 CGGGAATGGCCCGCCCTCGTGGG + Intergenic
1161780304 19:6287265-6287287 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1163556620 19:17997048-17997070 CAGGACTGTCCCTGCCTGGCCGG + Intronic
926120992 2:10241098-10241120 CAGGACTGTCCTTCCCCTGCAGG + Intergenic
930612111 2:53554858-53554880 CAGGGCTGTGACTCCCTCTTTGG + Intronic
932054627 2:68432040-68432062 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
932501561 2:72187223-72187245 CAGGGCTGTGACTCCCTCTTTGG - Intronic
933801059 2:85960820-85960842 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
934619742 2:95796928-95796950 CTGAACTGTCCCTCCCTCTGGGG + Intergenic
934641146 2:96027629-96027651 CTGAACTGTCCCTCCCTCTGGGG - Intronic
934699987 2:96431288-96431310 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
935518679 2:104077827-104077849 CAGGGCTGTCACTTCCTCTTTGG - Intergenic
937080698 2:119137621-119137643 CAGGTCTGTCCCGCCCTGCTGGG - Intergenic
938422428 2:131155545-131155567 CGGGGCTGTCCTTCCCTCATCGG + Intronic
940254543 2:151714883-151714905 CAGCCCTGTGCCTCCCTTGTTGG + Intronic
940588267 2:155684976-155684998 CAGGACTCACCTGCCCTCGTTGG - Intergenic
943820315 2:192314090-192314112 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
943858502 2:192828929-192828951 CAGGACTGTGACACCCTCTTTGG + Intergenic
946230441 2:218287833-218287855 CAGGACAGCCTCTCCCTCCTGGG - Intronic
948534925 2:238638635-238638657 CACGGCTGCCCCTCCTTCGTTGG - Intergenic
1169212598 20:3775798-3775820 CAGGCCTGTAACTCCCTTGTTGG + Intergenic
1169343039 20:4810611-4810633 CAGGGCTGCCCCTCCCTTGGAGG - Intronic
1170458463 20:16554735-16554757 CAGGGCTGTCACACCCTCTTTGG + Intronic
1170501116 20:16975704-16975726 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1173252737 20:41373278-41373300 CAGGTCTGTCCCCCTCTCTTGGG - Intergenic
1173926545 20:46785278-46785300 CAGGACTGTTCTTGCCTGGTTGG - Intergenic
1175001271 20:55632898-55632920 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1178467006 21:32858230-32858252 CAGGACTGTGACTCCCTCCTTGG - Intergenic
1179392606 21:41007844-41007866 CAGGACTGAGCCTCTCTCCTTGG + Intergenic
1179914140 21:44465305-44465327 CAGGAGTGTCCCTCCCAGATGGG + Intergenic
1182277989 22:29202400-29202422 CAGGACTGTCTCTCCAGCTTGGG - Intergenic
1182432530 22:30308666-30308688 CAGCACTGTCCCTCCCCAGCTGG + Intronic
1183381617 22:37493125-37493147 CAGGACTGTGTCACCCACGTGGG - Intronic
1184054179 22:42033323-42033345 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1184253272 22:43272872-43272894 CAGGACAGTCACTGTCTCGTGGG - Intronic
1184282080 22:43443013-43443035 CAGGATTGTCCCTGCCTGGGTGG + Intronic
1184431410 22:44443370-44443392 CAGGACTGTCACCCACTCCTGGG + Intergenic
1184617908 22:45650559-45650581 CAGGTGGGTCCCTCCCTCTTTGG + Intergenic
1184804939 22:46788622-46788644 CAGGACAGTGCCTGCCTCGTAGG + Intronic
1184869345 22:47225413-47225435 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
950219760 3:11185694-11185716 AATGACAGTCCCTCCCTCCTGGG + Intronic
950416310 3:12870785-12870807 GAGAACTGTCCCTTCCTCCTGGG + Intronic
950457715 3:13102582-13102604 CAGCACTGTCCTTCCCCGGTCGG + Intergenic
950808833 3:15632279-15632301 CAAGACAGACCCTTCCTCGTGGG - Intronic
951182199 3:19671781-19671803 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
952456991 3:33482608-33482630 AAGGACTGTGCCTACCTCCTGGG - Intergenic
952990898 3:38829773-38829795 CATGACTGTCCCTCCCTCATGGG - Intergenic
953766649 3:45747998-45748020 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
954862694 3:53703820-53703842 CAGGCCTGTCTCTCCCTAGGAGG - Intronic
957611501 3:82472800-82472822 CAGGAATGTGCCTCCCTAGGAGG + Intergenic
958675470 3:97264505-97264527 CAGGGCTGTGGCTCCCTCTTTGG - Intronic
959075330 3:101743486-101743508 CAGGACGGTCCCTTCAGCGTAGG - Intronic
959863583 3:111242322-111242344 CAGGACTGTGACTCCCTCTTTGG - Intronic
960333938 3:116393254-116393276 CAGGGCTGTGACTCCCTCTTTGG + Intronic
962200414 3:133396661-133396683 CAGGACTGCCTTTCCCTGGTGGG + Exonic
962785842 3:138767840-138767862 CAGGACTGTGACTTCCTCTTTGG - Intronic
963454172 3:145522551-145522573 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
963805247 3:149715277-149715299 CAGGGCTGTGACTCCCTCTTTGG + Intronic
964254965 3:154765984-154766006 CAGGACTGTGACTCCCCCTTTGG - Intergenic
964590618 3:158359639-158359661 CAGGACTGTGGCTCCCTCCTTGG - Intronic
964996870 3:162892361-162892383 CAGGGCTGTAACTCCCTCTTTGG + Intergenic
965813296 3:172613639-172613661 CAGGACTATGACTCCCTCTTTGG - Intergenic
968292609 3:197550457-197550479 CAGACCTGCCCCTCCCTCATAGG + Intronic
969581437 4:8067845-8067867 GAGGACTGTCCCTCCCTCTCAGG + Intronic
969708466 4:8829115-8829137 GAGGAGTGTCCCACCCTGGTAGG + Intergenic
972158739 4:36197884-36197906 CAGGGCTGTGACTCCCTCTTTGG - Intronic
973574582 4:52273879-52273901 CAGAACAGACCCTCCCTCCTGGG + Intergenic
974184571 4:58430053-58430075 CAGGACAGACCCTCTCTCCTGGG - Intergenic
974619991 4:64341715-64341737 CAGGCCTGTGACTCCCTCTTTGG + Intronic
975913761 4:79298427-79298449 CAGGGCTGTGACTCCCTCTTTGG + Intronic
976511029 4:85910218-85910240 CAGGGCTGTGACTCCCTCTTTGG - Intronic
976734441 4:88296056-88296078 CAGGACTGTGATTCCCTCTTTGG - Intergenic
977471954 4:97453129-97453151 CAGGGCTGTGACTCCCTCTTTGG + Intronic
978466822 4:109017039-109017061 CAGGGCTGTGACTCCCTCTTCGG + Intronic
979462948 4:121004029-121004051 CAGGACTGTGACTTCCTCTTTGG + Intergenic
980007683 4:127559981-127560003 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
980738362 4:136918772-136918794 CAGGACTGTGACTCCCTCTTTGG + Intergenic
981246388 4:142544668-142544690 CAGGCCTCTCCCTCCCTCTCTGG - Intronic
981627555 4:146776578-146776600 CAGTACTGGCCCTCCATAGTTGG - Intronic
985202837 4:187502226-187502248 TAGGAGGGTCTCTCCCTCGTGGG - Intergenic
985508916 5:300766-300788 CAGGAGTGTCCATCCCTCAGCGG + Intronic
985739208 5:1605150-1605172 CAGGAGTGTCCATCCCTCAGCGG - Intergenic
986812431 5:11374135-11374157 CAGGACTGTCTCTCACTTGAAGG - Intronic
987253796 5:16127638-16127660 TAGGACGGTCCCTCCCTGCTGGG - Intronic
990923384 5:60993290-60993312 CAGGGCTGTGACTCCCTCTTTGG - Intronic
991268587 5:64751582-64751604 CAGGACTGTCCTACCATTGTAGG + Intronic
995748360 5:115427745-115427767 CAGGTCTGTCCCTGACACGTGGG - Intergenic
998489084 5:142530312-142530334 CAGAACTGTCCCTACTTCATGGG + Intergenic
1001397527 5:171427978-171428000 CAGGACAGAACCTCCCTCCTGGG + Intronic
1002465423 5:179405939-179405961 CAGGACTGTCACTGCCCCGCGGG - Intergenic
1002668863 5:180848822-180848844 CAGGGCATTCCCTCCCTCATAGG + Exonic
1002677950 5:180934731-180934753 CAGGACTGTGACACCCTCTTTGG - Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006990633 6:38212131-38212153 CAGGAGTGGCCCTCCCTTGGTGG + Intronic
1007373859 6:41443443-41443465 CAGAGCTGACCCTCCCTCGGAGG + Intergenic
1010519781 6:76818484-76818506 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1012231096 6:96762141-96762163 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1014289390 6:119540472-119540494 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1015663820 6:135604474-135604496 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1017646037 6:156540865-156540887 CAGGGATGTCCCTCCACCGTGGG + Intergenic
1018659890 6:166076356-166076378 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1019626678 7:2019404-2019426 CAGGACTGTCTGACCCGCGTGGG - Intronic
1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG + Intronic
1021500688 7:21329478-21329500 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1023651212 7:42371248-42371270 CAGGAGATTCCCTCCCTCGCCGG - Intergenic
1026000441 7:66556611-66556633 CAGGACTGTCTGTGGCTCGTTGG - Intergenic
1026127205 7:67589363-67589385 CAGGACTTTCTCTCCATCTTTGG - Intergenic
1028816795 7:95156334-95156356 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1028995287 7:97093300-97093322 CAGGCCTGTCCCTGCCTCAGGGG + Intergenic
1035372283 7:158387130-158387152 CAGGACTTTCCCAGCCTCCTGGG - Intronic
1039711653 8:40061559-40061581 CCGGCCTCTCCCTCCCTCCTGGG - Intergenic
1041205416 8:55494303-55494325 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1045343656 8:101275295-101275317 CAGAACTGAGCCTCCCTCTTTGG + Intergenic
1048433214 8:134390091-134390113 CAGGAAGGACTCTCCCTCGTGGG + Intergenic
1050484044 9:6115123-6115145 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1050937298 9:11414234-11414256 CAGGACTGTGACACCCTCTTTGG + Intergenic
1052116078 9:24649660-24649682 CAGGACTGTGACACCCTCTTTGG + Intergenic
1052466713 9:28839073-28839095 CAGGACTGTGACACCCTCTTTGG - Intergenic
1052552465 9:29969204-29969226 CAGGGCTGTGACTCCCTCTTTGG - Intergenic
1052652306 9:31320857-31320879 CAGGGCTGTCACACCCTCTTTGG - Intergenic
1056832995 9:89931595-89931617 GAGGATTCTCCCTCCCACGTAGG - Intergenic
1057972299 9:99569680-99569702 CAGGACTGTCCCTCTATCCTAGG + Intergenic
1059401316 9:114072190-114072212 CAGGACTGTAACTCCCTCTTTGG + Intronic
1060182232 9:121542127-121542149 CAGGACAGGGCCACCCTCGTGGG + Intergenic
1060748230 9:126151757-126151779 GAGAAATGTCCCTCCCTCCTGGG + Intergenic
1060788670 9:126470496-126470518 CAGGGCAGTCCCTCCCTCCAGGG - Intronic
1062085586 9:134646393-134646415 CAGAAATGACCCTCCTTCGTGGG + Intronic
1185971042 X:4664236-4664258 CAGGACTATCCTGCCCTCATAGG - Intergenic
1187310137 X:18133933-18133955 CAGGCCTGGCCCTCACTCCTGGG + Intergenic
1189083673 X:37998361-37998383 AAGGGCTGTCACTCCCTCTTTGG + Intronic
1193108333 X:77703549-77703571 CAGGGCTGTGACTCCCTCTTTGG - Intronic
1194413162 X:93579568-93579590 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1199614880 X:149648393-149648415 CAGGGCTGTGACTCCCTCTTTGG + Intergenic
1199704043 X:150408754-150408776 CAGGACTGACTCCCCCGCGTTGG - Intronic