ID: 1020070781

View in Genome Browser
Species Human (GRCh38)
Location 7:5225719-5225741
Sequence GGCCCAAGTGTGCCCGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020070781 Original CRISPR GGCCCAAGTGTGCCCGTGAC AGG Intronic
900119400 1:1042055-1042077 GGCCCGTGTGTGCCCAGGACGGG + Exonic
900156306 1:1204650-1204672 GGCCCATGTCTGCCCGTCCCAGG + Intronic
900974980 1:6011316-6011338 GGGCCAAGTGTGCGGGAGACAGG + Intronic
915957925 1:160238691-160238713 TGGCCATGTGTGCCCGTGACGGG - Exonic
922334550 1:224608212-224608234 GGTCAAACTGTGCCCTTGACTGG - Intronic
922797985 1:228351010-228351032 GGGCCATGTGTTCCCGTGTCAGG + Intronic
922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG + Intergenic
923519721 1:234726083-234726105 GGCAAAAGTGTGCCCCTGTCTGG - Intergenic
1069915492 10:71784374-71784396 TGACCATCTGTGCCCGTGACCGG + Intronic
1070556775 10:77534022-77534044 GGCTCAAGTGTGCCCTTGGCAGG - Intronic
1074329354 10:112489113-112489135 GGCCCAGGTGGGGCCGAGACAGG + Intronic
1076321916 10:129589357-129589379 GGCCCAAGTGAGGCCCTGGCAGG - Intronic
1077541685 11:3149506-3149528 TGCCCATGTGTGCCTGTGGCAGG + Intronic
1077550122 11:3196534-3196556 GGCTGCAGTGTGCCAGTGACGGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1085048594 11:73367873-73367895 GGCACATGTGTGCCCCTGGCTGG - Exonic
1090225978 11:125072531-125072553 GGCCCCAGGGTGGCTGTGACGGG - Intronic
1095212619 12:39510762-39510784 GGGCCAAGTGTACCTGTCACTGG - Intergenic
1102857725 12:116308778-116308800 GGCACAGAAGTGCCCGTGACAGG - Intergenic
1104738406 12:131154193-131154215 AGCCCAAGTGTGGAGGTGACTGG + Intergenic
1113918154 13:113886951-113886973 GGAGCAAGTGTGTCAGTGACAGG - Intergenic
1113930396 13:113965219-113965241 AGCCCAACTGTGCCACTGACTGG + Intergenic
1119265975 14:73263525-73263547 GCCCCAAAAGTGCCTGTGACAGG + Intronic
1121272129 14:92644800-92644822 GGCCCAAGCCTGCCCATGCCAGG - Intronic
1121529810 14:94644355-94644377 GGGCCAAGGGAGCCCATGACAGG - Intergenic
1122858960 14:104573732-104573754 AGCCCAGGTGTGCCCGTCACTGG - Intronic
1124340292 15:28885968-28885990 GGCCCCAGTGTGCCCGGCGCGGG + Exonic
1125534250 15:40434365-40434387 GCCCTAAGTGTGCCTGTGAAAGG + Intronic
1127481411 15:59380945-59380967 GGCCCAAGTCAGATCGTGACAGG - Intronic
1131396693 15:92092008-92092030 GGCCCAGATGGGCCAGTGACTGG - Intronic
1131837922 15:96409050-96409072 GTCCCACGTGTGCACGTGAAGGG - Intergenic
1132206896 15:99992686-99992708 GCCCCAAGTGTCCCCATGGCAGG + Intronic
1135303410 16:21349755-21349777 GGCCCCAGTGTGGCCGAGATGGG + Intergenic
1136300158 16:29328949-29328971 GGCCCCAGTGTGGCCGAGATGGG + Intergenic
1137501242 16:49013257-49013279 GGCCTAGCTGTGCCCGGGACTGG + Intergenic
1140826351 16:78710203-78710225 GCCCCAAGTGTGCACGCCACTGG - Intronic
1141590178 16:85063208-85063230 GGCCCAAGAGTGCCTGAGGCTGG + Exonic
1142099992 16:88265958-88265980 GGCCCAAATTTGCACATGACGGG + Intergenic
1142751974 17:1994385-1994407 GGACCAAGTGTGTCCCTGGCTGG - Intronic
1145254232 17:21314047-21314069 AGCCCAAGTGTTCTCCTGACTGG - Intronic
1145322370 17:21773915-21773937 AGCCCAAGTGTTCTCCTGACTGG + Intergenic
1146167545 17:30601249-30601271 GGCCCAGGTGGGCTCGTGAAGGG + Intergenic
1152137085 17:78510878-78510900 GGGCCAAGTGTCCTCGTGACAGG + Intronic
1152795550 17:82304444-82304466 GGCCCTAGCCTCCCCGTGACAGG - Intergenic
1154529639 18:15330838-15330860 GGCCCAAGTATCCGCGTGGCTGG + Intergenic
1160964948 19:1743224-1743246 GGCCCTACTGTGCCCCTGCCCGG - Intergenic
1161637288 19:5396833-5396855 GACCCATGTGTGCCAGGGACTGG - Intergenic
1162362327 19:10227551-10227573 GGCCCAAGCCTGCCTGGGACTGG - Intronic
1164283177 19:23787209-23787231 GGCCCAAGTGTGCAAATCACAGG - Intronic
925131410 2:1496507-1496529 GGCACAAGCGCACCCGTGACAGG + Intronic
927969754 2:27298173-27298195 GGCCCAAGAGGGCCCCAGACTGG + Intronic
948601702 2:239111294-239111316 TGGGCAAGTGAGCCCGTGACAGG + Intronic
1172848708 20:37945137-37945159 GGGGCAGGTGTGCCCGTGATCGG - Exonic
1174080364 20:47967131-47967153 GGCCCAGGTGGGCCAGTGAAAGG - Intergenic
1174137231 20:48388147-48388169 GGCCCAAGGGGGCCAGTGAAAGG + Intergenic
1175967438 20:62666529-62666551 TGCCCCAGTGTGCCCATGGCGGG + Exonic
1178467146 21:32858988-32859010 GCCCCAAGTGTGCGCGTACCTGG + Intergenic
1179654231 21:42835164-42835186 AGTCCAAGTGGGCCCATGACTGG + Intergenic
1182316095 22:29448460-29448482 GGCCCAGGTGAGCCAGTGACAGG - Intergenic
1182686405 22:32123747-32123769 GGCCCAAGCTGGCCAGTGACTGG - Intergenic
1184639251 22:45860387-45860409 GGCCCAGGTGAGCCAGTGCCAGG + Intergenic
950248776 3:11446728-11446750 GGCCCAAGTAGCCCCTTGACTGG - Intronic
961448593 3:126992403-126992425 AGCCCATGTGTGCCCGCGAGTGG + Intronic
962413380 3:135161216-135161238 GACCCAAGTGTGCAGATGACAGG + Intronic
973642213 4:52914568-52914590 GACACAAGTGTGCCCGAGACAGG - Intronic
984639170 4:182144244-182144266 GGGCCGAGTGTGCCCGAGCCCGG - Intronic
1000605671 5:163325051-163325073 TGCAAAAGTGTGTCCGTGACAGG + Intergenic
1002485117 5:179530104-179530126 GGCCTGAGTGTGCCCGGGACGGG - Intergenic
1006519150 6:34561519-34561541 GGCCCAAGTGTGCCCAAGAGGGG - Intergenic
1007056327 6:38889158-38889180 GGCCACTGTGTGCCTGTGACAGG - Intronic
1007473676 6:42105906-42105928 GGCCCAAGTGTGGCCTTGGGTGG + Exonic
1007810331 6:44480995-44481017 GGCCCAAGGGGGGCCTTGACAGG - Intergenic
1007982921 6:46177602-46177624 GGCCCAGGTGTGCTTGTGAAGGG + Intergenic
1011626916 6:89290526-89290548 TGCCCAAGTGTGGCCGGGAAGGG + Intronic
1013174167 6:107663138-107663160 GCCCCAAGTGTGCTGCTGACTGG - Intergenic
1016847890 6:148587325-148587347 AGCCCAAGTGTGCCTGTAAGAGG + Intergenic
1017157561 6:151335849-151335871 GGCTCTAGTGTACCCGTCACCGG + Intronic
1018864881 6:167738520-167738542 GGCCCACGTGTGCCCAGCACTGG + Intergenic
1019477510 7:1251159-1251181 GGCCCATGTGGGGCGGTGACGGG + Intergenic
1019565812 7:1678542-1678564 GGCCCAAGGGTGTCCCAGACAGG - Intergenic
1020070781 7:5225719-5225741 GGCCCAAGTGTGCCCGTGACAGG + Intronic
1020117104 7:5482026-5482048 GCCCCAGGTGAGCCCGGGACGGG - Intronic
1021958704 7:25852286-25852308 GGCCCCAGTGAACCCGTTACAGG + Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1049805917 8:144538970-144538992 GGCCCCTGTGTCCCTGTGACAGG + Intronic
1050776985 9:9276127-9276149 GGCCAAAATGTGCCACTGACGGG - Intronic
1056752396 9:89362196-89362218 AACCCAAGTGGGCCTGTGACAGG - Intronic
1061936306 9:133859327-133859349 GTCCCAGCTGTGCCCGTGTCAGG - Intronic
1062271611 9:135712459-135712481 GGCCCCAGGGTCCCCGTGTCTGG + Intronic
1188154368 X:26722874-26722896 GGCCCACTTGTGCACGTGCCAGG + Intergenic
1188237483 X:27747758-27747780 TGGCCATGTGTGCCCGTGATGGG + Exonic
1189585458 X:42456494-42456516 GACCCAAGCGTGCACGTGAAAGG - Intergenic
1195382697 X:104285761-104285783 GCCCCAAGAGTGCCCCTGATGGG - Intergenic