ID: 1020071213

View in Genome Browser
Species Human (GRCh38)
Location 7:5228170-5228192
Sequence CACACTCGCCGCCCTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020071213_1020071217 -3 Left 1020071213 7:5228170-5228192 CCCCCAGGAGGGCGGCGAGTGTG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1020071217 7:5228190-5228212 GTGCCCTGATGAAGCAGCACCGG 0: 1
1: 0
2: 2
3: 18
4: 187
1020071213_1020071222 22 Left 1020071213 7:5228170-5228192 CCCCCAGGAGGGCGGCGAGTGTG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1020071222 7:5228215-5228237 AGTCTGCTCCGGCCGCTTCACGG 0: 1
1: 0
2: 0
3: 7
4: 53
1020071213_1020071220 11 Left 1020071213 7:5228170-5228192 CCCCCAGGAGGGCGGCGAGTGTG 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1020071220 7:5228204-5228226 CAGCACCGGTGAGTCTGCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020071213 Original CRISPR CACACTCGCCGCCCTCCTGG GGG (reversed) Exonic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900416167 1:2535736-2535758 CCCACACTCCGCGCTCCTGGCGG - Intergenic
901626887 1:10629735-10629757 CCCCCTCGCCTTCCTCCTGGGGG - Exonic
901698046 1:11024689-11024711 CACATTCCCCCACCTCCTGGAGG - Exonic
902456136 1:16535250-16535272 TACACTGGCCGCCCTCCCGCAGG - Intergenic
902496030 1:16872661-16872683 TACACTGGCCGCCCTCCCGCAGG + Intronic
903264998 1:22152846-22152868 CACAGTCCCTGCCCTCCTGGAGG - Intergenic
918952215 1:191152838-191152860 CACACTTTGAGCCCTCCTGGAGG + Intergenic
1065487614 10:26249912-26249934 CTCCTTCTCCGCCCTCCTGGTGG - Intronic
1069604809 10:69732423-69732445 CTCACTCTCAGTCCTCCTGGGGG - Intergenic
1071598198 10:86942980-86943002 CGCCTTCGCCGCCCTGCTGGAGG - Exonic
1071940623 10:90587748-90587770 CACATTCACTGCCCTCATGGAGG - Intergenic
1072001298 10:91198282-91198304 CACACTGGCCCCCTTGCTGGGGG + Intronic
1077101366 11:823987-824009 CCCACCCGCAGCCCTGCTGGAGG + Exonic
1077143325 11:1034395-1034417 CTCACTCATCCCCCTCCTGGGGG + Intronic
1077453135 11:2662809-2662831 GACACTCGCGGCCCTTCTGAGGG + Intronic
1083299080 11:61730881-61730903 CACACACGCCGCCCAGCTGGAGG + Intronic
1085273434 11:75283624-75283646 CTCACTACCAGCCCTCCTGGTGG - Intronic
1103261923 12:119595127-119595149 GGCGCTCGTCGCCCTCCTGGTGG - Intronic
1104870398 12:131991150-131991172 CACAATGCCCACCCTCCTGGGGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1115713634 14:36077416-36077438 CCCACTCTCCACCCTCCAGGAGG + Intergenic
1117266295 14:54090855-54090877 CACTCTGGATGCCCTCCTGGGGG - Intergenic
1117776456 14:59189110-59189132 AACACTCGCCGCCTTGCTGAAGG + Intronic
1119103643 14:71903924-71903946 CACAGTCTCTGCCCTCTTGGGGG + Intergenic
1122854742 14:104554684-104554706 CAGCCTCGCTGCCCTCCTGCAGG + Intronic
1124035148 15:26047845-26047867 CACAATTGCCTCCCTCCTTGGGG + Intergenic
1128525726 15:68410978-68411000 CACACTCCCCACCAGCCTGGGGG - Intronic
1129270440 15:74416781-74416803 CACACTCTCCTCCCTCCTTCGGG + Intronic
1129331543 15:74830386-74830408 CACACTCTTAGCCCTCATGGGGG - Exonic
1131061940 15:89409817-89409839 CCTACTCCCCGCCCTCTTGGCGG - Intergenic
1139364503 16:66425675-66425697 CCCACTCCCCGCCCTCCTGCAGG - Intergenic
1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG + Exonic
1139896113 16:70289234-70289256 GACACTCGCAGCGCTCCCGGGGG + Intronic
1139921554 16:70463717-70463739 CACCCTCAACGCCCTGCTGGTGG + Exonic
1140683598 16:77411188-77411210 CATACTCGCTGCCATCCTGCTGG + Intronic
1143510973 17:7394773-7394795 CACGCACGCCGCCGGCCTGGCGG - Exonic
1147334285 17:39717313-39717335 CACACTGGTCAGCCTCCTGGGGG - Exonic
1147603910 17:41763306-41763328 CACTCTCCAGGCCCTCCTGGAGG + Exonic
1147744264 17:42685464-42685486 CTCTCTCACCGCCCTCCTCGTGG + Intronic
1148432411 17:47652593-47652615 CCCCCTCGCCGCCCCTCTGGTGG + Intronic
1150199331 17:63337770-63337792 CCCACTCTCCGCCCTCCGGTAGG + Intronic
1151077116 17:71286817-71286839 CACACTCACCTACATCCTGGTGG - Intergenic
1151674079 17:75589053-75589075 CCCGCTGGCGGCCCTCCTGGTGG + Intergenic
1152568289 17:81109933-81109955 CACCCACGCCCCCCACCTGGGGG + Intronic
1153720142 18:7893537-7893559 AACACTGGCCGCCCTCATGCAGG + Intronic
1155994958 18:32321424-32321446 CACTCTCTTAGCCCTCCTGGGGG + Intronic
1157157316 18:45280641-45280663 CTGACTCTCAGCCCTCCTGGAGG + Intronic
1160346889 18:78139569-78139591 CACACCCGCCTCTCTCCTGCAGG + Intergenic
1160676090 19:392203-392225 CAAAATCCCTGCCCTCCTGGAGG + Intergenic
1161364118 19:3868603-3868625 CCCTCTCGCTGCCCTCCTCGTGG + Intronic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
1161720049 19:5897554-5897576 CACTCTCGACCCCCTCCTGCTGG + Intronic
1165981524 19:39728370-39728392 CACACACTCCCCCATCCTGGTGG + Intergenic
1202646209 1_KI270706v1_random:144410-144432 CACAATCATCTCCCTCCTGGAGG + Intergenic
1202707022 1_KI270713v1_random:31606-31628 TACACTGGCCGCCCTCCCGCAGG - Intergenic
925068810 2:950745-950767 CCCGCTCGCCGCCCTCCCCGCGG + Intergenic
928324543 2:30309207-30309229 CAGACTGGCCACCCTCCTGCAGG + Intronic
930368324 2:50471723-50471745 CACACTCTCCACCCTCCAGTAGG - Intronic
936403235 2:112181942-112181964 CTCACCCACCGCCCTCCTGCCGG + Intronic
938134207 2:128740542-128740564 CACACTCACGGGCCTGCTGGGGG - Intergenic
938170233 2:129069541-129069563 CACACTCACGGCACACCTGGAGG + Intergenic
938319960 2:130356055-130356077 CACACTCGCCGCGCGCGCGGCGG + Exonic
943686145 2:190820198-190820220 CACACTGAGCGCCATCCTGGAGG - Intergenic
944150185 2:196549292-196549314 CACACTCCCCTCCCTCCTCCAGG + Intronic
945047509 2:205794881-205794903 CTCACTGGGCGTCCTCCTGGGGG + Exonic
946402886 2:219477768-219477790 CACACCTGCCGATCTCCTGGTGG - Exonic
948378593 2:237538224-237538246 CGCAGGCCCCGCCCTCCTGGGGG - Intronic
948409688 2:237749532-237749554 CACACGGTCCGCCCTGCTGGGGG - Intronic
948584352 2:239009638-239009660 CCCACTCGCCTCCCTCTGGGAGG + Intergenic
948627507 2:239278063-239278085 CACACTCGGCTCCCCGCTGGTGG + Intronic
1170833971 20:19868081-19868103 CACACTCACAGGCCTCCTTGGGG - Intergenic
1172794132 20:37525466-37525488 CACACTCACAGCCCTGCTGATGG - Intronic
1173140899 20:40481899-40481921 CACACTTCCTGCCATCCTGGTGG + Intergenic
1173609390 20:44355698-44355720 CGCACTCACCGCCTTCCTGGTGG + Intronic
1174758920 20:53187135-53187157 GACACTCGCCGCACGTCTGGGGG + Intronic
1176205498 20:63885936-63885958 CCCACTCACAGCCCTCCTCGGGG - Intronic
1178976660 21:37226550-37226572 CACACCCTCCACCCTTCTGGGGG - Intronic
1179112754 21:38461465-38461487 CACATTCTCTGCCTTCCTGGAGG - Intronic
1179279660 21:39923842-39923864 CACACACCACGCCCTCCTAGTGG - Intronic
1180103244 21:45599714-45599736 CTCACACGCCTCCCTCCAGGAGG + Intergenic
1180866323 22:19122033-19122055 CACCCGCGGCGCCCTCCTGCAGG - Intronic
949297770 3:2546488-2546510 CACACTCGCCACCCTCAAGGAGG - Intronic
950506026 3:13395098-13395120 CACACTCCCCCCTCTCCTGGAGG - Intronic
950674365 3:14545584-14545606 CACAATAGCTTCCCTCCTGGAGG + Intergenic
954136491 3:48584418-48584440 CACTCTCGCCCCCCTCGTGTTGG + Intronic
954443838 3:50536071-50536093 CACGCTGGCCGCCCTCGAGGGGG - Intergenic
963980964 3:151536320-151536342 CACCCTCTCTGCCCTCGTGGTGG - Intergenic
966194294 3:177298060-177298082 CACACTTGGCCCCCTCCTGCTGG + Intergenic
967200798 3:187070827-187070849 CACAGTCCCTGCCCTCCAGGAGG - Intronic
969597824 4:8158868-8158890 CACTCTCACGCCCCTCCTGGCGG + Intergenic
971288434 4:25312642-25312664 CGCAGTCCCCGCCCACCTGGGGG - Intergenic
980969753 4:139557015-139557037 CCCACTCCCCGCCCTCCTTCGGG + Intronic
986236108 5:5912248-5912270 CACACTCCCCTCCTCCCTGGGGG - Intergenic
998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG + Intergenic
998406179 5:141876097-141876119 CACACTCGGCGTCCTCTGGGAGG - Intronic
998444338 5:142187022-142187044 CACCCGCACCGCCCTCCCGGTGG + Intergenic
1000156638 5:158558780-158558802 CACACTCACCGTCACCCTGGAGG - Intergenic
1001600562 5:172925627-172925649 CTCACTCTCCTTCCTCCTGGGGG + Intronic
1001932607 5:175683935-175683957 GACACTGGCCGCCGTCATGGGGG + Exonic
1002049531 5:176562291-176562313 CATACTGGCCGCCCTCCCTGGGG - Intronic
1002535260 5:179872390-179872412 CACATTCCCAGCCCTCCTGCAGG - Intronic
1006357370 6:33567892-33567914 CACCCTCCCCACCCTGCTGGGGG + Intergenic
1006452120 6:34111348-34111370 CACACTCACAGGCCTCTTGGTGG + Intronic
1007166954 6:39835513-39835535 CACAGTCCCTGCCCTCCTGCAGG - Intronic
1012399502 6:98832629-98832651 CACTCTGGCCGCGCGCCTGGGGG - Intergenic
1013693644 6:112674763-112674785 CACCTTCTCTGCCCTCCTGGAGG - Intergenic
1018753518 6:166828331-166828353 CACACCCGCCACCTTCCTGTGGG + Intronic
1018768446 6:166952317-166952339 CTCACACACAGCCCTCCTGGAGG + Intronic
1019302213 7:311594-311616 CACCCCCGCCCCCCTCCTGGAGG + Intergenic
1019312948 7:371652-371674 CTCACTCTCCTCCTTCCTGGTGG + Intergenic
1019312959 7:371684-371706 CTCACTCTCCTCCTTCCTGGTGG + Intergenic
1019568022 7:1694268-1694290 CACACTGGCCTCCCTGCGGGTGG + Exonic
1019935000 7:4249077-4249099 CACACTCACCTCCCTCCCTGAGG - Intronic
1020071213 7:5228170-5228192 CACACTCGCCGCCCTCCTGGGGG - Exonic
1021998507 7:26202177-26202199 ACCACGCGCCGCCCTCCGGGAGG - Intronic
1022020807 7:26398254-26398276 CACACCCGCCGCCCGCTTGCAGG + Intergenic
1027219285 7:76203762-76203784 CACTCGCGCTGTCCTCCTGGAGG + Intronic
1034269150 7:149795290-149795312 CACCCAGGCTGCCCTCCTGGGGG + Intergenic
1034303716 7:150035648-150035670 AACACTCGCAGTCCTCCAGGTGG + Intergenic
1034781894 7:153888336-153888358 CAGGCACGCGGCCCTCCTGGGGG - Intronic
1035336722 7:158134020-158134042 CACACTCGGGGGCCTCCTGCAGG - Exonic
1036751212 8:11444596-11444618 CGCACAGGGCGCCCTCCTGGAGG + Exonic
1037585100 8:20270655-20270677 CACACCTGCCCACCTCCTGGAGG - Intronic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1038767508 8:30442714-30442736 CACACTGGCCGCCATTGTGGTGG + Intronic
1039475299 8:37836469-37836491 CTGACTCGCCACCCACCTGGGGG + Intronic
1049235455 8:141510273-141510295 CACTCTCTCTGCCCCCCTGGAGG - Intergenic
1049742392 8:144247378-144247400 CACAGTCCACGGCCTCCTGGCGG - Exonic
1053010303 9:34629052-34629074 CTCACTCGCCGCGCTGCTTGCGG + Intergenic
1057215133 9:93223773-93223795 CACACTCCACGCCCTCCTGGTGG - Intronic
1059610207 9:115884255-115884277 CACAATCCCTGCCCTCATGGTGG - Intergenic
1062016687 9:134294634-134294656 CAAACACCCCGACCTCCTGGGGG + Intergenic
1062170736 9:135133373-135133395 CACCCGAGCCACCCTCCTGGTGG - Intergenic
1062569605 9:137179074-137179096 CCCGCCCGCCGGCCTCCTGGCGG + Intronic
1062716369 9:138012262-138012284 CCCACTGGACACCCTCCTGGTGG + Intronic
1187271916 X:17787740-17787762 CTCACTCACCTCTCTCCTGGTGG - Intergenic
1192202104 X:69073012-69073034 CACCATTGCCTCCCTCCTGGAGG + Intergenic
1194130859 X:90080057-90080079 CACACTTTCAGCCCTTCTGGAGG + Intergenic
1199990738 X:152986404-152986426 CACACATGCCGCCCTCCTCAGGG + Intergenic
1200033827 X:153315878-153315900 CACACATGCCGCCCTCCTCAGGG + Intergenic
1200071751 X:153532595-153532617 CAGACTGGCCGGCCTCGTGGTGG - Intronic