ID: 1020073121

View in Genome Browser
Species Human (GRCh38)
Location 7:5240438-5240460
Sequence CCCAAGGACACAGTCTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020073121_1020073130 -2 Left 1020073121 7:5240438-5240460 CCTGGTCAGACTGTGTCCTTGGG No data
Right 1020073130 7:5240459-5240481 GGGGCTGGGCGGTCGCACCCGGG No data
1020073121_1020073129 -3 Left 1020073121 7:5240438-5240460 CCTGGTCAGACTGTGTCCTTGGG No data
Right 1020073129 7:5240458-5240480 GGGGGCTGGGCGGTCGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020073121 Original CRISPR CCCAAGGACACAGTCTGACC AGG (reversed) Intergenic
No off target data available for this crispr