ID: 1020073129

View in Genome Browser
Species Human (GRCh38)
Location 7:5240458-5240480
Sequence GGGGGCTGGGCGGTCGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020073119_1020073129 -2 Left 1020073119 7:5240437-5240459 CCCTGGTCAGACTGTGTCCTTGG No data
Right 1020073129 7:5240458-5240480 GGGGGCTGGGCGGTCGCACCCGG No data
1020073121_1020073129 -3 Left 1020073121 7:5240438-5240460 CCTGGTCAGACTGTGTCCTTGGG No data
Right 1020073129 7:5240458-5240480 GGGGGCTGGGCGGTCGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020073129 Original CRISPR GGGGGCTGGGCGGTCGCACC CGG Intergenic
No off target data available for this crispr