ID: 1020073130

View in Genome Browser
Species Human (GRCh38)
Location 7:5240459-5240481
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020073119_1020073130 -1 Left 1020073119 7:5240437-5240459 CCCTGGTCAGACTGTGTCCTTGG No data
Right 1020073130 7:5240459-5240481 GGGGCTGGGCGGTCGCACCCGGG No data
1020073121_1020073130 -2 Left 1020073121 7:5240438-5240460 CCTGGTCAGACTGTGTCCTTGGG No data
Right 1020073130 7:5240459-5240481 GGGGCTGGGCGGTCGCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020073130 Original CRISPR GGGGCTGGGCGGTCGCACCC GGG Intergenic