ID: 1020078631

View in Genome Browser
Species Human (GRCh38)
Location 7:5274821-5274843
Sequence TTGTCAAAAGGGCTGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 2, 2: 1, 3: 18, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020078631_1020078637 12 Left 1020078631 7:5274821-5274843 CCTTCACCCAGCCCTTTTGACAA 0: 1
1: 2
2: 1
3: 18
4: 214
Right 1020078637 7:5274856-5274878 AACACTTATCAGGCCCTCCTCGG No data
1020078631_1020078636 2 Left 1020078631 7:5274821-5274843 CCTTCACCCAGCCCTTTTGACAA 0: 1
1: 2
2: 1
3: 18
4: 214
Right 1020078636 7:5274846-5274868 TTCTTTCAACAACACTTATCAGG 0: 3
1: 1
2: 3
3: 15
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020078631 Original CRISPR TTGTCAAAAGGGCTGGGTGA AGG (reversed) Intronic
902227156 1:15003672-15003694 TTGGGAAAAGGGGTGGGGGACGG + Intronic
902650991 1:17837520-17837542 TTGTCAAGGGGGCTGGGAAAGGG + Intergenic
902683981 1:18063814-18063836 TTGTCACAAGGTCGGGGGGATGG - Intergenic
904619646 1:31767518-31767540 TGGTGAACAGGGCTGAGTGAGGG - Intergenic
904819624 1:33233384-33233406 GTGTGAGAAGGGATGGGTGAGGG - Intergenic
905450938 1:38055764-38055786 TAGCCAAAAGCGCTGGGTAATGG + Intergenic
906244208 1:44261831-44261853 TTGGCAGAAGGGCTGGGTATGGG + Intronic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
907992950 1:59600570-59600592 GTGTCCAAAGAGCTGGGTGCAGG - Intronic
910063997 1:83130819-83130841 ATGGCAAAAGGGCTTGGTGGTGG - Intergenic
911357325 1:96838380-96838402 TTGTGAACATGGCTGGATGAGGG + Intergenic
916923179 1:169490278-169490300 TTGTCAAAATGGCGGGGGGACGG + Intergenic
917854198 1:179088108-179088130 TAGTCAGGAGGGCTGGGGGAGGG + Intronic
919188276 1:194182593-194182615 TTGGAAAAAGGGATGGGTAAAGG + Intergenic
920543236 1:206794884-206794906 TTGGCAAAAGTGCTGTGGGATGG + Intergenic
921046341 1:211480370-211480392 TTGGTTAAAGGGATGGGTGAGGG + Intronic
923395077 1:233553872-233553894 TTGTCAAAAAGGCTTTGTGGAGG - Intergenic
923537434 1:234863875-234863897 CTGCCAAATGGGCTGGGTGAAGG - Intergenic
924250113 1:242124103-242124125 GTGTCAGAAGAGCTGGGTGCTGG + Intronic
1063732401 10:8712876-8712898 GTGTGACAAGGGCTGGTTGATGG + Intergenic
1067658637 10:48216973-48216995 TTGTCAAAAGGGCAGGGAGGAGG + Intronic
1068061386 10:52072055-52072077 GAGTCATAAGGGCTGGGTGAAGG - Intronic
1070466879 10:76732808-76732830 TGGTCATAGGGGCTGGGTGGGGG - Intergenic
1071434610 10:85635602-85635624 TTGTCCTCAGGGCTGGCTGAGGG - Intronic
1072424679 10:95320145-95320167 TTGGCAAGAGAGCTGGGGGAAGG - Intronic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1074604789 10:114950826-114950848 TTGTCTAATTGGCTGGGTTAAGG + Intronic
1074704672 10:116120269-116120291 TTGCCAACAGTGCTGGGTCAAGG - Intronic
1075483286 10:122800136-122800158 TGGGCAAAAGGGCTGGGGGCAGG + Intergenic
1075790764 10:125082876-125082898 TTCTCAGAAAGGCTGGGTGCAGG - Intronic
1076321469 10:129585241-129585263 TTCACAATAGGGCTGGTTGATGG + Intronic
1078005119 11:7526783-7526805 TAGTGACAAGGGCTGGGAGAGGG + Intronic
1078829738 11:14968189-14968211 TTGTGAATGGGGCTGGGTGTGGG - Intronic
1079368831 11:19832647-19832669 ATCTCAAAAGGCCGGGGTGAGGG + Intronic
1081984123 11:47289276-47289298 TCCTCAGAAGGGCTGGGTGAGGG - Intronic
1083608298 11:63992256-63992278 TTTTAAACAGGGCTTGGTGAAGG + Intronic
1086594928 11:88559339-88559361 TTGTCATAAGGGCTGGAATAAGG + Intronic
1086942532 11:92813344-92813366 GTGGGAGAAGGGCTGGGTGAAGG - Intronic
1087172213 11:95060733-95060755 TTTTCAAAGGGGCTGTATGATGG - Intergenic
1088131090 11:106491940-106491962 TTGTTAAAATGGCTGGGAGTGGG + Intergenic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1088742150 11:112775934-112775956 TTGTCAATATGCCTGGGTGGAGG + Intergenic
1088752685 11:112857968-112857990 ATGTCAAGAGGGATGTGTGAGGG + Intergenic
1090533271 11:127613331-127613353 TTGTCAAAATGTCAGGGTTATGG - Intergenic
1092855721 12:12672019-12672041 TTATGAGAAGGGCCGGGTGAAGG + Intronic
1096647168 12:53045201-53045223 ATGTTAAAAGAGCTGGTTGAAGG + Intergenic
1100113386 12:91272627-91272649 CTGCCAACAGGGCTGGGAGATGG + Intergenic
1100736731 12:97543253-97543275 TTGACAAAAAGGCTTGGTGCGGG - Intergenic
1102852815 12:116266255-116266277 TTGTCTCCAGGGCTGAGTGAAGG + Intronic
1102951450 12:117034211-117034233 TTTACAAAAGGGCCGTGTGATGG - Intergenic
1104634293 12:130427966-130427988 TGGCCAAAAGGTCTGGGTAAAGG - Intronic
1105232572 13:18511863-18511885 ATCTCAAAAGGGATGGGTGGGGG + Intergenic
1106745736 13:32704468-32704490 GTGTAAAAAGGACTGGGTCAAGG - Intronic
1107011238 13:35673447-35673469 CTGGCAGGAGGGCTGGGTGAGGG - Intergenic
1108165693 13:47690622-47690644 TTGTCAAAATGGATGGATAATGG + Intergenic
1108403278 13:50071522-50071544 TTGTAAAAACGGATGGGTGCAGG + Intergenic
1108874975 13:55035475-55035497 GTGTTAATTGGGCTGGGTGAAGG + Intergenic
1112744627 13:102512648-102512670 TGGTCTAAAGGACTGGGAGAAGG - Intergenic
1113080056 13:106509984-106510006 CTGTCATAAGGGCTGGGTGGAGG - Intronic
1113540865 13:111108153-111108175 TCATCAAAGGAGCTGGGTGAAGG + Intergenic
1115892676 14:38049301-38049323 ATGTCAAAAGGACAGGGTAAAGG + Intergenic
1116499249 14:45600615-45600637 TTGTCAAAATGGCAGGCCGAAGG - Intergenic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1118216702 14:63815642-63815664 TTGGGAAAAGGGCAGTGTGATGG - Intergenic
1118809542 14:69262715-69262737 TTGTCAAAAGTGGTGCCTGACGG - Intronic
1119265795 14:73262713-73262735 TTCTCCAAAGGCCTGGGTGTGGG - Exonic
1121277717 14:92679188-92679210 CTGACAAAAGGGCTGGATGCAGG - Intronic
1122641037 14:103159567-103159589 TGGGCACAAGGGCTGGGTCATGG + Intergenic
1125989986 15:44096768-44096790 TTGTGAAATGGGCTGGGTCAAGG - Intronic
1126932999 15:53675821-53675843 TTGAATAAAGTGCTGGGTGAGGG + Intronic
1128994339 15:72285771-72285793 TTTTTAAAAGGGCAGGGTGGGGG + Exonic
1129622469 15:77160863-77160885 TTGTCAAAAAGGGTTGGTGAAGG + Intronic
1131539675 15:93265799-93265821 TTATCAAGAGGGCTTGGTGAAGG + Intergenic
1131824373 15:96306219-96306241 ATGTGAGAAGGTCTGGGTGAAGG - Intergenic
1132627591 16:899091-899113 TTGTCCCAGGGGCTGTGTGACGG + Intronic
1133302252 16:4789613-4789635 TTTTAAAAAGGGCTGGGCGCAGG - Intronic
1133965405 16:10527503-10527525 TTGTCCATATGGCTGGGGGATGG - Intergenic
1135770760 16:25216805-25216827 ATCTCAACAGGGCAGGGTGAGGG - Intronic
1139672238 16:68499737-68499759 TTGTTAGCAGGGCTGGGTGGGGG - Intergenic
1140416440 16:74777033-74777055 TTGTCAAAAGACAGGGGTGAGGG + Intergenic
1141490720 16:84370807-84370829 TGGTCAAAGTGGCTGGGGGAGGG - Intronic
1142743951 17:1945837-1945859 CTGTCACAATGGCTGGATGAAGG + Intronic
1145735845 17:27231176-27231198 TTATCAAAAGGGGTGGGGGAAGG + Intergenic
1146710717 17:35039194-35039216 CTGTCATATGGGCTGGGTGCAGG - Intronic
1146930914 17:36777208-36777230 CTATAAAAAGGGCAGGGTGAGGG - Intergenic
1147610802 17:41800971-41800993 CTGGAAAAAGGGCTGGGTCAAGG - Intergenic
1148054795 17:44787601-44787623 GGGTGAAAAGGGCTGGGTTATGG - Intergenic
1149572725 17:57685052-57685074 TTATCAACAGTGCTGGGAGAAGG + Intergenic
1150273447 17:63881417-63881439 TTGTCAAAAAGCCTGGATAAGGG + Exonic
1150279058 17:63918404-63918426 TTGTCAAAAAGCCTGGATAAGGG + Exonic
1152673889 17:81626797-81626819 TTTTAAAATGGACTGGGTGAGGG + Intronic
1154520743 18:15226822-15226844 ATCTCAAAAGGGATGGGTGGGGG - Intergenic
1155154396 18:23146166-23146188 TTTTAAGAAGGGCTGGGTGGCGG + Intronic
1155473041 18:26210276-26210298 ATGTCAATTTGGCTGGGTGAAGG + Intergenic
1155858228 18:30862547-30862569 TTGTGGAAAGCTCTGGGTGAAGG - Intergenic
1157105411 18:44770073-44770095 TTCTCAAAAGAGCTGGGAGGAGG - Intronic
1157476595 18:48027966-48027988 TTGACAAAAGGGCTCAGTGCAGG - Exonic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1163056192 19:14720213-14720235 TTGCAAGAAGGGCTGGGAGATGG - Exonic
1166210486 19:41303779-41303801 CTGTCATAAGGGCTGGGACAGGG + Intronic
1166230763 19:41424854-41424876 TTCTCCCAGGGGCTGGGTGAGGG + Exonic
925943597 2:8841069-8841091 TTGTAAACAGGGCGGGGTGGAGG - Intergenic
927379965 2:22468008-22468030 CTGTCAAAAAGGCTGGGTGGGGG + Intergenic
927767286 2:25822447-25822469 TTGTGAACAGGGCAGGGGGACGG - Intronic
927857429 2:26536268-26536290 TTGTCAAATGGGGTTGGTGATGG - Intronic
930980340 2:57517954-57517976 ATGTCAATAGGGCAGGGTGAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933136515 2:78742497-78742519 TTTTAAAAAGGGCTTGGTGGGGG - Intergenic
933372616 2:81435672-81435694 TTGTCAACTTGGCTAGGTGAAGG - Intergenic
933921146 2:87047720-87047742 TTGGCAAAAGGGATGGGAGGAGG - Intergenic
933930489 2:87146075-87146097 TTGGCAAAAGGGATGGGAGGAGG + Intergenic
934001820 2:87721865-87721887 TTGGCAAAAGGGATGGGAGGAGG + Intergenic
934045008 2:88165758-88165780 TTGTAATAAGGACTGGGTGCTGG - Intergenic
934481883 2:94656900-94656922 ATGTCAAAATGGCTGGGCGTGGG - Intergenic
935310085 2:101775050-101775072 TTTTTAAAGGGGCTGAGTGATGG + Intronic
935401522 2:102665363-102665385 TTGTTAAAAGTGCTCGATGATGG + Intronic
936362641 2:111819371-111819393 TTGGCAAAAGGGATGGGAGGAGG - Intronic
936889651 2:117354479-117354501 TTGTCAGAAGGGCTTGGGGGAGG - Intergenic
937341650 2:121095182-121095204 TTCTCAGAGGGGCTGGGTAAAGG + Intergenic
937391396 2:121490459-121490481 TTGTAAAAAGGGTTGGGGGTTGG + Intronic
938520096 2:132060593-132060615 ATCTCAAAAGGGATGGGTGGGGG - Intergenic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942385956 2:175443116-175443138 TTCTGAAAAGGGCTGTGGGAGGG - Intergenic
942922919 2:181398835-181398857 TTGTCAAAAGGAATAAGTGATGG + Intergenic
943659690 2:190545692-190545714 TTTTAAAAAGGGGTGGGTGGAGG + Intergenic
945026439 2:205624153-205624175 GCATCAAAAGGGCTGTGTGACGG + Intergenic
948169404 2:235888932-235888954 TTGCCAAAAACTCTGGGTGAGGG + Intronic
948243700 2:236460446-236460468 TTGACAAAAGGGCAAGGAGACGG - Intronic
1169482638 20:5998608-5998630 TTGTCACAAGGGCTAGGAGTGGG - Intergenic
1169579041 20:6998135-6998157 TTGTGAAAAGGGTTGGGTCCGGG + Intergenic
1172106740 20:32521665-32521687 ATGAAAAAAGGGCTGGGTGGGGG + Intronic
1173673413 20:44813525-44813547 TTGTCAAAAATGGTGGGTGGGGG + Intergenic
1174982821 20:55416597-55416619 TTGTCAAAAGAACTGATTGATGG + Intergenic
1176776550 21:13140172-13140194 ATCTCAAAAGGGATGGGTGGGGG + Intergenic
1177153143 21:17474934-17474956 TTGTGAACATGGCTGGGTAATGG - Intergenic
1179899203 21:44380105-44380127 GTGTCGGAAGGGCTGGGTGGAGG + Intronic
1183039062 22:35162443-35162465 TTTTCAAAGGGGGTGGGAGAAGG + Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1185383175 22:50519471-50519493 TCTTCAAAAGGGCTGGTTGCAGG - Intronic
949371612 3:3340858-3340880 TTGTAAAGAGGACTGGGAGAAGG + Intergenic
949715777 3:6929691-6929713 TTGTAAACAGGGCTGGGTGTAGG - Intronic
949890868 3:8733035-8733057 CTGTCACTAGGGCAGGGTGAAGG + Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950297629 3:11845878-11845900 TTGTTAAAAGTGCTGAGCGAGGG + Intronic
951098900 3:18663738-18663760 TTGTCAGAGGGATTGGGTGAAGG - Intergenic
951689451 3:25380476-25380498 TTATGACAAGGGCTGGGTCAGGG - Intronic
953463925 3:43103445-43103467 TGGACAGCAGGGCTGGGTGAGGG - Intronic
954003494 3:47575878-47575900 TTGGAAAAAGGGCTGGGTTGAGG - Intronic
954416909 3:50397804-50397826 TTGTCCAGAGGGCTGGTTAAAGG - Intronic
955307346 3:57847210-57847232 TTGTCAACAGGACTTGGTAATGG - Exonic
955378542 3:58418107-58418129 TTAAAAAAAGGGCTGGGTGTGGG - Intronic
955512630 3:59696759-59696781 TTGGAAAAAGGGCTTGGTGGGGG - Intergenic
955617222 3:60822124-60822146 TTGTTAAAAGGGCAGAATGAAGG + Intronic
957228896 3:77485929-77485951 CTGTCAAAAGGGCATGGTGAGGG - Intronic
957587492 3:82150791-82150813 TTGTCAAAATGGATGTGTGGTGG + Intergenic
957917974 3:86710193-86710215 TATTCAAAAGGGCTGGGTATGGG - Intergenic
960550789 3:118973945-118973967 TTGTCAGAGGGGCCGGGGGAAGG + Intronic
960616210 3:119598431-119598453 TTGTCATCCTGGCTGGGTGATGG + Intronic
968383145 4:111982-112004 GTGTCAGAAGGACTGGGAGATGG - Intergenic
969088136 4:4671689-4671711 CTGTCAACTGGGCTGGGAGAGGG + Intergenic
973610895 4:52635249-52635271 ATGGCCAAAGGGCAGGGTGAGGG - Intronic
977177394 4:93834283-93834305 TTGTGAAAAGGGTTAGGAGATGG + Intergenic
980771698 4:137381300-137381322 ATGTCAAATGGGCTGAGTCACGG + Intergenic
983577985 4:169279105-169279127 TAGTCAAAAGGTCAGGGGGAGGG + Intergenic
987955249 5:24730211-24730233 TTGTTGAAAGGGCGGGGGGAGGG + Intergenic
988293291 5:29319293-29319315 TTGTCAAATTGACTGGGTTAAGG + Intergenic
989099358 5:37809908-37809930 GTGTCAAAAGGGCAGGGTGGTGG - Intergenic
989567708 5:42917248-42917270 TTGTAATAAGGGCTGGAAGAGGG + Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992845211 5:80739882-80739904 TTCTCTAAAGTTCTGGGTGAGGG + Intronic
992979034 5:82147829-82147851 TTGGCACAAGGACTGGGGGAGGG - Intronic
997534811 5:134611151-134611173 ATGTCATAATGGCTGGGTGTGGG - Intronic
998395674 5:141816435-141816457 TTGTCCAAAGGGTTGGGTTGGGG - Intergenic
998423379 5:142007283-142007305 ATTACAAAAGGACTGGGTGAGGG + Intronic
999808452 5:155105914-155105936 AAGTCAAAAGGGCTAGTTGAAGG - Intergenic
1000836169 5:166156851-166156873 TTGTCAATAGTGCTGAGTGTGGG + Intergenic
1001629005 5:173160644-173160666 GTGTCGGCAGGGCTGGGTGAGGG + Intronic
1004352585 6:14903167-14903189 TTGATACAAGGGTTGGGTGAGGG + Intergenic
1005049085 6:21666900-21666922 GTTTCAAAAGGGTGGGGTGAGGG + Intergenic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1010125955 6:72432018-72432040 GTGTCAGAAGAGCTGAGTGAGGG + Intergenic
1010613216 6:77981781-77981803 TAGGCAACAGGGCAGGGTGAAGG - Intergenic
1011171562 6:84510278-84510300 TTATCAAATGGGCTGTGAGAGGG - Intergenic
1012392189 6:98755132-98755154 TTATCAAGAGGGATGGGGGATGG - Intergenic
1013658463 6:112270205-112270227 TTATTAAAAGGGCTGGGAGTGGG - Intergenic
1019643966 7:2119338-2119360 CTGTCAGAAAGGGTGGGTGATGG - Intronic
1020078631 7:5274821-5274843 TTGTCAAAAGGGCTGGGTGAAGG - Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1025708864 7:63890182-63890204 TTCTCAAAAGGGAAGTGTGATGG - Intergenic
1025708876 7:63890243-63890265 TTCTCAAAAGGGAAGTGTGATGG - Intergenic
1025708888 7:63890304-63890326 TTCTCAAAAGGGAAGTGTGATGG - Intergenic
1030638265 7:111974598-111974620 GTGACAAAAGGGGAGGGTGAAGG + Intronic
1030804334 7:113896222-113896244 TTCACAAAAGGTGTGGGTGAGGG - Intronic
1032085141 7:128879858-128879880 TGGTCAGCAGGGCTGGGTGTAGG + Intronic
1033327280 7:140390261-140390283 TGGTCAAAAGGGCTGGGGGTGGG - Intronic
1033494095 7:141876713-141876735 CTGGCAAAAGGGCAGGGTGCTGG + Intergenic
1034973925 7:155436963-155436985 TGGTCAAGAGTGCTGGGTGGGGG - Intergenic
1037844908 8:22274652-22274674 TTGACAAAATGGTTGGGAGAGGG + Intergenic
1038722791 8:30052576-30052598 TTTTAAAAAGGGCTTGATGAAGG - Intergenic
1039224369 8:35372042-35372064 TTATCAAATGGTCAGGGTGAGGG - Intronic
1039575230 8:38618158-38618180 TTGTCAAAAGGGCTACATAAAGG - Intergenic
1040522277 8:48188406-48188428 TTGCCAACAGGGCTGGGAGGTGG + Intergenic
1044652092 8:94506764-94506786 TTCTCAAAAGTGCTAAGTGATGG - Intronic
1048362506 8:133710397-133710419 TTGGCAAAGGGGCTGCATGAGGG - Intergenic
1048610341 8:136015330-136015352 TTCTCAGAAGGGCTGAGAGAGGG + Intergenic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1051222899 9:14869066-14869088 TAGTCCAAGGGGCAGGGTGAGGG + Exonic
1051666706 9:19472887-19472909 GTGTCAAATTGGCTGGATGATGG + Intergenic
1055017755 9:71637280-71637302 TTTTCTAAAGGGCTGGGTAGGGG - Intergenic
1056969525 9:91190918-91190940 TTGTAAAAGGGGCTGGGGGGTGG - Intergenic
1058763266 9:108157458-108157480 TTGTCAGAAGAGCTGAATGATGG - Intergenic
1059988202 9:119840160-119840182 TTGTGAAAAGGGCAGGGTATTGG - Intergenic
1060068736 9:120528108-120528130 CCGGCAACAGGGCTGGGTGAAGG + Intronic
1061946360 9:133910441-133910463 CTGTCAAATGGGCTTGGTGCCGG - Intronic
1062122308 9:134840298-134840320 TTGTGAGAAGGGCAGGGTCAGGG + Intronic
1062370004 9:136233669-136233691 TGGTCAAAAGGGAGGGGAGAAGG + Intronic
1062519281 9:136950941-136950963 TTGTAAGCAGGGCTGGATGAGGG + Intronic
1062520262 9:136954681-136954703 TTGTGAGCAGGGATGGGTGAGGG - Intronic
1185528591 X:799177-799199 TTGCCACAGGGGCTGGGGGATGG - Intergenic
1186030210 X:5360005-5360027 TTGTTAGCAGGGCTGGGTGGTGG - Intergenic
1186290599 X:8093597-8093619 ATGTCACAAAGGTTGGGTGAGGG + Intergenic
1186989586 X:15052972-15052994 TTGTCAAAACTGTTGGGTGGGGG - Intergenic
1187460262 X:19480512-19480534 TTTTAAAAAGGGCCGGGTGCGGG + Intronic
1188339665 X:28983332-28983354 TTGTCAGAAGGACTGGGAAAGGG - Intronic
1188582067 X:31726001-31726023 TCTGCAAAAGGGCTGGGTCAGGG - Intronic
1189261845 X:39684753-39684775 CTGTAACAATGGCTGGGTGATGG + Intergenic
1190248800 X:48707319-48707341 TTGTTAGAAGGCCTGGATGAAGG - Intronic
1192670911 X:73140248-73140270 TTGTTAAAAGGGATGGGTTAAGG - Intergenic
1192798846 X:74447033-74447055 TTGGCCTAAGGCCTGGGTGAAGG + Intronic
1195071379 X:101283953-101283975 GTTTTCAAAGGGCTGGGTGAGGG + Intronic
1195632781 X:107076543-107076565 TAGTCACCAGGGCTGGGGGAAGG + Intronic
1196104028 X:111877081-111877103 TTGGCAAAAGGGATGGGAGTAGG + Intronic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1198830106 X:140741406-140741428 TTGTCAAAAGGGCTGGGTTGAGG + Intergenic