ID: 1020080394

View in Genome Browser
Species Human (GRCh38)
Location 7:5283268-5283290
Sequence CCGGGTCCGCGCTTGTCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 2, 2: 0, 3: 1, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020080394_1020080403 1 Left 1020080394 7:5283268-5283290 CCCGGCGACAAGCGCGGACCCGG 0: 1
1: 2
2: 0
3: 1
4: 54
Right 1020080403 7:5283292-5283314 CCCCTGGGCCCTCGCCATGGAGG No data
1020080394_1020080408 4 Left 1020080394 7:5283268-5283290 CCCGGCGACAAGCGCGGACCCGG 0: 1
1: 2
2: 0
3: 1
4: 54
Right 1020080408 7:5283295-5283317 CTGGGCCCTCGCCATGGAGGGGG 0: 1
1: 2
2: 2
3: 29
4: 233
1020080394_1020080401 -2 Left 1020080394 7:5283268-5283290 CCCGGCGACAAGCGCGGACCCGG 0: 1
1: 2
2: 0
3: 1
4: 54
Right 1020080401 7:5283289-5283311 GGACCCCTGGGCCCTCGCCATGG 0: 1
1: 2
2: 2
3: 12
4: 235
1020080394_1020080407 3 Left 1020080394 7:5283268-5283290 CCCGGCGACAAGCGCGGACCCGG 0: 1
1: 2
2: 0
3: 1
4: 54
Right 1020080407 7:5283294-5283316 CCTGGGCCCTCGCCATGGAGGGG 0: 1
1: 2
2: 2
3: 14
4: 231
1020080394_1020080405 2 Left 1020080394 7:5283268-5283290 CCCGGCGACAAGCGCGGACCCGG 0: 1
1: 2
2: 0
3: 1
4: 54
Right 1020080405 7:5283293-5283315 CCCTGGGCCCTCGCCATGGAGGG No data
1020080394_1020080409 8 Left 1020080394 7:5283268-5283290 CCCGGCGACAAGCGCGGACCCGG 0: 1
1: 2
2: 0
3: 1
4: 54
Right 1020080409 7:5283299-5283321 GCCCTCGCCATGGAGGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020080394 Original CRISPR CCGGGTCCGCGCTTGTCGCC GGG (reversed) Intronic
906525224 1:46489774-46489796 CCGGGCCCGCGCCGGGCGCCCGG + Intergenic
922757186 1:228102960-228102982 TCGGGCCCGCGCATGGCGCCCGG + Exonic
1076548311 10:131260705-131260727 CCGGGTCCTGGCTCGTCCCCTGG - Intronic
1105243566 13:18628498-18628520 GCGCGTCCCCGCTCGTCGCCCGG + Intergenic
1105476273 13:20730385-20730407 TCCGGGCCGCGCTTGTCCCCTGG - Intronic
1106735932 13:32587179-32587201 CCGGGTCCCCGCGCGCCGCCTGG + Intronic
1123487730 15:20756133-20756155 GCGGGTCTCCGCTCGTCGCCCGG - Intergenic
1129852342 15:78800589-78800611 CCGGGTCCTTGCTGGTGGCCGGG + Intronic
1131096155 15:89655402-89655424 CCGGGACGGCGCTTGCAGCCAGG - Exonic
1132514258 16:359060-359082 CCGGGTCCATACTTGTCCCCTGG + Intergenic
1132544783 16:528075-528097 CCGGGCCCGCGCTCCCCGCCCGG - Intronic
1134246364 16:12543279-12543301 CTGGGTCCGTGCCTGTGGCCCGG + Intronic
1135536970 16:23302208-23302230 CCGGGACCGTGCGTGTGGCCAGG + Intronic
1142110426 16:88328144-88328166 CCGAGTCTGTGCTTCTCGCCCGG + Intergenic
1142176142 16:88646311-88646333 CCCGGTCCGCGCACGTCCCCTGG - Intronic
1143175022 17:4950468-4950490 CTGGGACAGCACTTGTCGCCCGG - Intronic
1143202826 17:5123613-5123635 CTGGCTCCCCGCTTGTCCCCAGG - Intronic
1151478708 17:74357589-74357611 CCGGGCCCGCGCCTCCCGCCAGG + Exonic
1152080097 17:78181781-78181803 CAGGGTCTGGCCTTGTCGCCCGG + Intronic
1163440431 19:17320032-17320054 CCGGGCCCGCCCCTGTCGCCCGG - Exonic
1164678166 19:30117068-30117090 CCTGGTCCGCGCTTATCACTGGG - Intergenic
1165763566 19:38336482-38336504 CCGGGCCCCCGTTTCTCGCCCGG - Intronic
1167072821 19:47230640-47230662 CCGGGGCCGCACTGGCCGCCAGG + Intronic
1167425120 19:49426283-49426305 CCGGGGCCCAGCTTGGCGCCAGG - Intronic
1167648170 19:50716886-50716908 CCTCGTCCTCGCTTGTCGCGGGG + Exonic
927859307 2:26550628-26550650 CTGGGTCCGCGGTGGTCCCCAGG + Intronic
942313966 2:174682145-174682167 CCCGGTCAGTGCTTTTCGCCCGG - Intronic
944213073 2:197226635-197226657 CGGAGTCTGCTCTTGTCGCCAGG - Intronic
1175773064 20:61635786-61635808 CCTGGTCCGCGCCTGCCCCCAGG + Intronic
1176450611 21:6858476-6858498 GCGCGTCCCCGCTCGTCGCCCGG + Intergenic
1176828781 21:13723494-13723516 GCGCGTCCCCGCTCGTCGCCCGG + Intergenic
1180699709 22:17774539-17774561 CCGGGTCCCCGCAAGCCGCCGGG - Intronic
1181030909 22:20148561-20148583 CCGGGGCAGTGCTGGTCGCCTGG + Exonic
1181054243 22:20252638-20252660 CAGGGTCTGCTCTGGTCGCCTGG - Intronic
1181359128 22:22321838-22321860 CCGGGTCCTCTCTTGTCGTGTGG - Intergenic
1181512414 22:23394826-23394848 CTGGGGCAGCGCTGGTCGCCTGG - Intergenic
1181535054 22:23537482-23537504 CCGGGTCCCCGCTGGCTGCCTGG + Intergenic
1182380399 22:29883134-29883156 GCGCGTCCTCGCTCGTCGCCCGG + Exonic
1184724490 22:46335669-46335691 TAGGGTCCGCGCTAGTGGCCCGG - Exonic
1184766953 22:46577132-46577154 CCGCCTCCGCGCTCGTGGCCGGG + Intronic
1185130895 22:49038025-49038047 TCGGGTCCTCGCCTGCCGCCAGG + Intergenic
950467923 3:13166444-13166466 CAGGGTCAGTGCTTGTCCCCTGG - Intergenic
955818873 3:62875118-62875140 CCGGGTGGGCGCTTCTCCCCAGG + Exonic
968659554 4:1793462-1793484 CCAGGTCCGTGCTTGGGGCCGGG + Exonic
975473341 4:74794510-74794532 CCGGCTCCGTGAATGTCGCCGGG + Exonic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
999727196 5:154446532-154446554 CCGCGGCCGCGCTTGCCGCGGGG - Exonic
1001761779 5:174213768-174213790 CCAGGTCCCAGCTTGTCTCCTGG + Intronic
1002312766 5:178324681-178324703 CTGGGTGCGCGCTTGTGGCACGG - Intronic
1017943605 6:159075679-159075701 CTGGGTCTGGGCTTGTTGCCAGG + Intergenic
1020080394 7:5283268-5283290 CCGGGTCCGCGCTTGTCGCCGGG - Intronic
1025198522 7:56948911-56948933 CCGGGTCGGCGCTTGTCGCCGGG + Intergenic
1025673429 7:63628022-63628044 CCGGGTCGGCGCTTGTCGCCGGG - Intergenic
1034418684 7:150978062-150978084 CCGGGTCCTCGCTCGGCTCCCGG + Exonic
1038632787 8:29262513-29262535 CCGGGACCCCGCGTCTCGCCCGG - Intronic
1040661706 8:49582696-49582718 CCAGGTCCTCGCTTGGCCCCAGG - Intergenic
1203518571 Un_GL000213v1:26041-26063 GCGCGTCCCCGCTCGTCGCCCGG - Intergenic
1197873576 X:131082536-131082558 CTGGGTCCGCGCTAACCGCCTGG - Intronic