ID: 1020084135

View in Genome Browser
Species Human (GRCh38)
Location 7:5301581-5301603
Sequence AGCATCCCTCCAGCTGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 2, 2: 2, 3: 9, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020084129_1020084135 21 Left 1020084129 7:5301537-5301559 CCAGGGGATGGAGCAGAAGAGGA 0: 1
1: 1
2: 4
3: 48
4: 549
Right 1020084135 7:5301581-5301603 AGCATCCCTCCAGCTGCCGTGGG 0: 1
1: 2
2: 2
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020084135 Original CRISPR AGCATCCCTCCAGCTGCCGT GGG Intronic
900475813 1:2875890-2875912 GGCACTCTTCCAGCTGCCGTGGG + Intergenic
900486258 1:2924212-2924234 AGCCTCCCACCAGCTGGCTTCGG + Intergenic
901788930 1:11643148-11643170 AGCATCCCTCCTACTGCCTGGGG + Intergenic
903021869 1:20400465-20400487 AGCATCCCCCTGGCTGCCGTGGG + Intergenic
903998248 1:27321989-27322011 AGCATCCCTTCTGCAGCCGCGGG + Intergenic
905267331 1:36763929-36763951 AGGCTCCCTCTGGCTGCCGTGGG + Intergenic
905794639 1:40808653-40808675 AGGATCCCTCCAGCTTCCACAGG - Intronic
906610611 1:47199332-47199354 ACCATTCTTCCAGCTGCAGTTGG - Intergenic
908664594 1:66476096-66476118 AGCTCCCTTCCAGCTGCTGTTGG + Intergenic
908774228 1:67624983-67625005 AGCTTCCCTGCAGCTGGGGTTGG - Intergenic
915229786 1:154436731-154436753 TGCATCCCTCCAGCTGTGGTGGG - Intronic
915357179 1:155262301-155262323 AGGATCCCCGCAGCAGCCGTGGG + Intronic
915400600 1:155618968-155618990 AGCAAATCTCCAGCTGCCGAAGG + Intergenic
915418125 1:155757974-155757996 AGCAAATCTCCAGCTGCCGAAGG + Exonic
918007335 1:180554248-180554270 AGGATCCTTCCAGCTTCTGTTGG - Intergenic
918151027 1:181798433-181798455 AGCATCTCTCCACCTGCTGATGG + Exonic
919290071 1:195618749-195618771 AGCATCCCTCTGGCTTCTGTTGG - Intergenic
921650715 1:217674693-217674715 ACCATCCATCCAGCTGCAGATGG - Intronic
923146791 1:231203880-231203902 AGCATTTCTCCAGCTGCAGTAGG - Exonic
923769426 1:236925232-236925254 GGCATCTTTCCAGTTGCCGTGGG + Intergenic
1064006830 10:11705435-11705457 AGAATCCCTCCAGCTGCGGCAGG - Intergenic
1064743093 10:18453197-18453219 AAAATCCCTCCAGCTGTCGTGGG - Intronic
1072668963 10:97415278-97415300 ACCATCCCTGGAGCTGCCATGGG + Intronic
1075092901 10:119453438-119453460 GGGATCCCATCAGCTGCCGTGGG - Intronic
1076300523 10:129422183-129422205 AACCTCACTCCAGCTGCCTTTGG - Intergenic
1076658097 10:132037501-132037523 AGCCTCCCTCCACCTGCGGGTGG + Intergenic
1078670728 11:13362748-13362770 AGCATCTCGAGAGCTGCCGTCGG + Intronic
1080247072 11:30191542-30191564 AGCATCTTTCCAGCTGTGGTAGG + Intergenic
1089881229 11:121775625-121775647 AGGATCACTCTAGCTGCCTTGGG + Intergenic
1095133665 12:38572177-38572199 AGCATTCCTGGAGCTGCCTTGGG + Intergenic
1096025247 12:48355150-48355172 AGCATTCTTCCTGCTGCTGTTGG + Intergenic
1096699459 12:53372522-53372544 ACCATGCCTCCAACTGCTGTTGG + Intergenic
1102006814 12:109594420-109594442 TGCCTCCCTACAGCTGCCTTGGG - Intronic
1106418578 13:29566968-29566990 ATCATGGCTCCAGTTGCCGTTGG + Intronic
1107987030 13:45784587-45784609 TGCATCCCACCAGATGCCTTAGG - Intronic
1108352045 13:49596666-49596688 AGCCTCCCTGCAGCTGCAGCTGG - Intergenic
1113784801 13:112996807-112996829 AGCCCCCGTCCAGGTGCCGTGGG - Intronic
1114610761 14:24038643-24038665 ACCAGCCTTCCAGCTGCCGAAGG + Intergenic
1115533210 14:34345894-34345916 AGCCTCCCTGCCCCTGCCGTGGG - Intronic
1118098376 14:62565870-62565892 AGTATCACTCTAGCTGCTGTGGG + Intergenic
1119718463 14:76875066-76875088 AGCCTCACCCCAGCTGCCCTTGG - Intergenic
1120898896 14:89558783-89558805 ACCATTGCCCCAGCTGCCGTAGG + Intronic
1122657933 14:103274218-103274240 AGGCACCCTCCAGCGGCCGTGGG + Intergenic
1122874259 14:104656297-104656319 AGCATCCCGCCGGCTCCCATGGG + Intergenic
1124517182 15:30376618-30376640 TGCAGCGCTCCAGCTGCCGGGGG - Intronic
1124725762 15:32154376-32154398 TGCAGCGCTCCAGCTGCCGGGGG + Intronic
1127759367 15:62122647-62122669 AGCAGCCATCCAGATGCCGTTGG - Intergenic
1129464152 15:75714526-75714548 AGCTTCCATCCAGGTGCCCTAGG + Intergenic
1129696587 15:77743714-77743736 AGCATCCCTCCTGCGCCCCTGGG - Intronic
1132222025 15:100112197-100112219 AGCATCCCTCCAGCTGAGGTTGG - Intronic
1137478254 16:48829544-48829566 AGTATCCCTTCTGCTGCTGTTGG + Intergenic
1137844231 16:51671430-51671452 TGCATCCCTCCAGAAGCTGTGGG - Intergenic
1141199092 16:81883366-81883388 AGCATCCCGCCAGCTCCCTCAGG - Intronic
1141953688 16:87355791-87355813 AGCTTCCCTCCACCTGCCTCGGG + Intronic
1143751084 17:9028337-9028359 AACCTCACTCCAGCTGCCATGGG - Intronic
1143923088 17:10346427-10346449 AGCCTCCCTCCAGCTCCTCTGGG - Intronic
1144954910 17:19014290-19014312 AGCATCCTTCCACCTTCCTTAGG + Intronic
1148542605 17:48492491-48492513 GGCATTCCTTCAGCTGCGGTGGG - Intergenic
1149186303 17:54001716-54001738 AGCCTCCCTCCAGCCACAGTGGG + Intergenic
1153819853 18:8824026-8824048 GGAATCCCTCCAGCTGGGGTGGG - Intronic
1157602952 18:48905412-48905434 AGCATCCCTCCACCTTCTATTGG - Intergenic
1158023599 18:52870375-52870397 GCCATCGCTCCAGCTGCTGTGGG - Intronic
1160528852 18:79552171-79552193 AGCCTCCCTCCAGCCTCCCTGGG + Intergenic
1161074115 19:2276620-2276642 TGCATCCCTCCAGCAGCAGGAGG + Intronic
1161769665 19:6224320-6224342 AGAATCCCCCCAGCTGGCCTGGG + Intronic
1163497671 19:17656018-17656040 AGCCTCCCGCCAGCTGCCCCAGG - Exonic
925988097 2:9232001-9232023 TCCATTCCTCCAGCTGCAGTGGG + Intronic
926045896 2:9709461-9709483 AGCAGCCCTGCTGCTGCCCTTGG + Intergenic
927704623 2:25289508-25289530 AGTATCGCTCCAGCTCCCCTAGG - Intronic
928241085 2:29587114-29587136 AGCATCCCTCCAGTTGCCCTGGG - Intronic
929484472 2:42341529-42341551 CCCAGCCCTCCTGCTGCCGTGGG + Intronic
929604678 2:43226577-43226599 AGCAGTCCGCGAGCTGCCGTCGG - Exonic
931917247 2:66969550-66969572 AGCATCCATGCAGCTGCCCCAGG + Intergenic
935219855 2:101002812-101002834 AGTATCCCTCTAGCCGCCCTGGG + Intronic
938147428 2:128848441-128848463 AGCTTCCCAGCAGCTGCTGTGGG + Intergenic
940255930 2:151729289-151729311 ACCATCCCTCCTGCTGCTGTTGG + Intronic
942763909 2:179431529-179431551 AGCATCCCTCAGGCTGCTCTGGG + Intergenic
944329859 2:198453002-198453024 AGTATCCCTCCAGCTGTCAAAGG + Intronic
1172062875 20:32198798-32198820 ACCAACCCACCAGCTGCCTTTGG + Intronic
1175949845 20:62577601-62577623 TGCTGCCCTCCAGCTGCCCTTGG - Intergenic
1179481492 21:41681537-41681559 AGCCTCCTCCCAGCTGCCCTGGG - Intergenic
1179889873 21:44330120-44330142 AGCCACCCTCCAGCTCCCGGGGG + Exonic
1179983937 21:44910849-44910871 AGCTCCCCTCCAGCTGGCCTGGG + Intronic
1183186887 22:36296946-36296968 AGTCTCCCTCCAGCTTCCGGCGG + Exonic
1183317094 22:37142732-37142754 TAGATCACTCCAGCTGCCGTGGG - Intronic
1183362214 22:37388651-37388673 AGCCTCCCTCCAGCCTCAGTTGG + Intronic
1184728906 22:46362468-46362490 AGAAGCCCTACAGCTGCCTTCGG - Exonic
1185349228 22:50326021-50326043 AGCCTCCCTCCATCTGCAGGTGG + Intronic
951332924 3:21387339-21387361 AGCCTCCCCCCACCCGCCGTGGG - Intergenic
954148571 3:48646392-48646414 AGAATCCCTCCAGCTTCTGCTGG + Intronic
960944881 3:122958946-122958968 CACATCCCTCCAGCTGCAATGGG + Intronic
961818056 3:129561421-129561443 GGCCTCTCTCCAGCTGCCGCAGG + Intronic
969408708 4:7013642-7013664 AGCACCCCTCCAGCTGACAGAGG - Intronic
977166905 4:93710997-93711019 AGCATTTCTACAGCTGCCCTGGG - Intronic
985200897 4:187484348-187484370 AGCATCTCCACTGCTGCCGTGGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985675977 5:1231533-1231555 AGCAGCCCTCAAGCCGCCCTGGG + Intronic
985758514 5:1733188-1733210 ACCATCCCTCCGGCTGCTGCAGG - Intergenic
986499222 5:8381016-8381038 AGCATTCCCACAGCTCCCGTGGG + Intergenic
990243275 5:53837202-53837224 AGCGTCCCCCCACCTGCCATGGG + Intergenic
992895208 5:81239607-81239629 TGCATGCCTCCACCTGCCCTGGG - Intronic
992895368 5:81240525-81240547 TGCATGCCTCCATCTGCCCTGGG - Intronic
993020437 5:82584831-82584853 AGCATCACTGCAGCTCCAGTTGG - Intergenic
993971067 5:94420630-94420652 AGCATTGATCCAGGTGCCGTTGG - Intronic
1000212383 5:159119402-159119424 AGCCTCCCCCCACCTGCCATGGG + Intergenic
1002705626 5:181159683-181159705 AGCCTCCCTCCTGCTGCCCTTGG + Intergenic
1002758056 6:179868-179890 AGCCTCCCCCCAGCCGCCGTGGG + Intergenic
1003126317 6:3358855-3358877 ACCATCCCTCCAGCCCCCGATGG - Intronic
1004694295 6:18019762-18019784 AGCCTCCCCCCCGCCGCCGTGGG - Intergenic
1015539269 6:134297890-134297912 AGCCTCACTCCGGCTGCGGTTGG + Intronic
1015753150 6:136581553-136581575 ACCATCTCCCCAGCTGCAGTAGG - Intronic
1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG + Intergenic
1018903508 6:168062787-168062809 AGCATCCCTGCAGCGGTCATGGG - Intronic
1020084135 7:5301581-5301603 AGCATCCCTCCAGCTGCCGTGGG + Intronic
1025210149 7:57015615-57015637 AGCATCCCCCCAGCTGCCGTGGG - Intergenic
1025661802 7:63561236-63561258 AGCATCCCCCCAGCTGCCGTGGG + Intergenic
1026932940 7:74234953-74234975 AGCCTCCCTCCCACTGCAGTTGG + Intronic
1027778981 7:82499844-82499866 AGCCTCCCCCCACCTACCGTGGG + Intergenic
1027974489 7:85133362-85133384 AGCATACATACAGCTGCCGATGG + Intronic
1033733232 7:144198054-144198076 TGCTTCCCTCCAGCTTCAGTTGG + Intergenic
1033749818 7:144352933-144352955 TGCTTCCCTCCAGCTTCAGTTGG - Intergenic
1034275473 7:149822019-149822041 AGCAGGCCTCCAGCAGCCCTGGG - Intergenic
1036182261 8:6595631-6595653 AGCATCGTTCCAGCTGCTGCAGG + Intronic
1036984635 8:13514769-13514791 AGGCTCCCTCCAGCTGCAGAGGG - Exonic
1045011350 8:97961534-97961556 AGTATCCCTCCAGCTGGGCTTGG + Intronic
1050294662 9:4193693-4193715 AGCCTCCCTCCAGCTCAGGTGGG - Intronic
1051825211 9:21211641-21211663 AGCATCCCTCCGGCTGGGGAAGG + Intronic
1053061541 9:35036034-35036056 ATTATCCCTCCAGCGGACGTCGG + Intergenic
1057178141 9:93014147-93014169 AGCATCCCTCCCCCAGCCATAGG + Intronic
1062111880 9:134786255-134786277 AGCATCCCTCCACCTGTCCCGGG - Intronic
1062449746 9:136610462-136610484 AGCTCCCCTCCAGCGCCCGTGGG - Intergenic
1190380616 X:49836903-49836925 CTCATCCCTCCAGCTGGCCTTGG + Intergenic
1199657109 X:150006946-150006968 AGCATCCCTCTACCTACTGTAGG - Intergenic