ID: 1020085883

View in Genome Browser
Species Human (GRCh38)
Location 7:5310025-5310047
Sequence CCATCAACTCAGGCGGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020085883_1020085893 23 Left 1020085883 7:5310025-5310047 CCCTCGGCCGCCTGAGTTGATGG No data
Right 1020085893 7:5310071-5310093 ATTTTTATTTTTGTAGAGATGGG No data
1020085883_1020085892 22 Left 1020085883 7:5310025-5310047 CCCTCGGCCGCCTGAGTTGATGG No data
Right 1020085892 7:5310070-5310092 TATTTTTATTTTTGTAGAGATGG 0: 149
1: 635
2: 6396
3: 23162
4: 157955
1020085883_1020085895 25 Left 1020085883 7:5310025-5310047 CCCTCGGCCGCCTGAGTTGATGG No data
Right 1020085895 7:5310073-5310095 TTTTATTTTTGTAGAGATGGGGG 0: 85
1: 444
2: 1580
3: 3933
4: 8581
1020085883_1020085894 24 Left 1020085883 7:5310025-5310047 CCCTCGGCCGCCTGAGTTGATGG No data
Right 1020085894 7:5310072-5310094 TTTTTATTTTTGTAGAGATGGGG 0: 359
1: 3601
2: 14951
3: 41341
4: 166449
1020085883_1020085890 -5 Left 1020085883 7:5310025-5310047 CCCTCGGCCGCCTGAGTTGATGG No data
Right 1020085890 7:5310043-5310065 GATGGGATTACAGGAATCCACGG 0: 1
1: 0
2: 5
3: 40
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020085883 Original CRISPR CCATCAACTCAGGCGGCCGA GGG (reversed) Intronic