ID: 1020088718

View in Genome Browser
Species Human (GRCh38)
Location 7:5325226-5325248
Sequence AAGAAGAAAGGGAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5022
Summary {0: 1, 1: 3, 2: 50, 3: 586, 4: 4382}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020088718_1020088727 18 Left 1020088718 7:5325226-5325248 CCAGCCTCTTTCCCTTTCTTCTT 0: 1
1: 3
2: 50
3: 586
4: 4382
Right 1020088727 7:5325267-5325289 GAGAGGAGCCATCAAACGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 82
1020088718_1020088730 29 Left 1020088718 7:5325226-5325248 CCAGCCTCTTTCCCTTTCTTCTT 0: 1
1: 3
2: 50
3: 586
4: 4382
Right 1020088730 7:5325278-5325300 TCAAACGGCAGGGAAAGCACAGG 0: 1
1: 0
2: 1
3: 6
4: 145
1020088718_1020088726 14 Left 1020088718 7:5325226-5325248 CCAGCCTCTTTCCCTTTCTTCTT 0: 1
1: 3
2: 50
3: 586
4: 4382
Right 1020088726 7:5325263-5325285 AGCAGAGAGGAGCCATCAAACGG 0: 1
1: 0
2: 2
3: 29
4: 304
1020088718_1020088725 1 Left 1020088718 7:5325226-5325248 CCAGCCTCTTTCCCTTTCTTCTT 0: 1
1: 3
2: 50
3: 586
4: 4382
Right 1020088725 7:5325250-5325272 TGGAGGAGGAAGCAGCAGAGAGG 0: 1
1: 2
2: 8
3: 150
4: 1405
1020088718_1020088728 19 Left 1020088718 7:5325226-5325248 CCAGCCTCTTTCCCTTTCTTCTT 0: 1
1: 3
2: 50
3: 586
4: 4382
Right 1020088728 7:5325268-5325290 AGAGGAGCCATCAAACGGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020088718 Original CRISPR AAGAAGAAAGGGAAAGAGGC TGG (reversed) Exonic
Too many off-targets to display for this crispr