ID: 1020092219

View in Genome Browser
Species Human (GRCh38)
Location 7:5348181-5348203
Sequence AGACACTTGCTTCCAAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020092210_1020092219 9 Left 1020092210 7:5348149-5348171 CCCCCCACCAAAAAGAGAGACTG 0: 1
1: 0
2: 3
3: 35
4: 311
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092211_1020092219 8 Left 1020092211 7:5348150-5348172 CCCCCACCAAAAAGAGAGACTGT 0: 1
1: 0
2: 2
3: 25
4: 276
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092213_1020092219 6 Left 1020092213 7:5348152-5348174 CCCACCAAAAAGAGAGACTGTCT 0: 1
1: 0
2: 0
3: 18
4: 185
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092215_1020092219 2 Left 1020092215 7:5348156-5348178 CCAAAAAGAGAGACTGTCTTGAG 0: 1
1: 0
2: 2
3: 22
4: 249
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092214_1020092219 5 Left 1020092214 7:5348153-5348175 CCACCAAAAAGAGAGACTGTCTT 0: 1
1: 0
2: 4
3: 31
4: 252
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092208_1020092219 27 Left 1020092208 7:5348131-5348153 CCTGCACACAAACCAAAACCCCC 0: 1
1: 0
2: 3
3: 16
4: 239
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092212_1020092219 7 Left 1020092212 7:5348151-5348173 CCCCACCAAAAAGAGAGACTGTC 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092209_1020092219 15 Left 1020092209 7:5348143-5348165 CCAAAACCCCCCACCAAAAAGAG 0: 1
1: 0
2: 0
3: 50
4: 475
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161
1020092207_1020092219 28 Left 1020092207 7:5348130-5348152 CCCTGCACACAAACCAAAACCCC 0: 1
1: 0
2: 2
3: 20
4: 309
Right 1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG 0: 1
1: 0
2: 2
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020092219 Original CRISPR AGACACTTGCTTCCAAGGAC GGG Intronic
900768613 1:4522257-4522279 AAACACATGGTTCCAAGGATTGG + Intergenic
901545206 1:9951162-9951184 AGTTACTTGCCTCGAAGGACTGG + Intronic
902611413 1:17599691-17599713 AGACACTTTCCACCAATGACAGG - Intronic
904415342 1:30358033-30358055 AGACACCTGCCTCCCAGGAGGGG + Intergenic
910276340 1:85453222-85453244 AGAAACTTCCTTCTGAGGACTGG + Intronic
910511567 1:88012248-88012270 AGACCCTTGCTTCCTAGTAAAGG + Intergenic
911363491 1:96908676-96908698 AGACACTTGATTTCTATGACTGG + Intergenic
920167187 1:204044307-204044329 AGACAAATTCTTCCTAGGACTGG + Intergenic
921045056 1:211470279-211470301 ACAAACTTGATTCCCAGGACCGG + Intergenic
922857459 1:228787300-228787322 AGACACTTGCCCCGAAGGCCAGG + Intergenic
923392175 1:233523337-233523359 AAACAATTGCTTCAAAAGACAGG + Intergenic
923400609 1:233613070-233613092 AGGCACTTACTTACAAAGACTGG - Intergenic
924137784 1:240988847-240988869 AGCCACTGGCTTCCAGGAACTGG + Intronic
924144550 1:241060565-241060587 AGTCAGTTGCTTCCAAGTCCAGG - Intronic
1062876118 10:944270-944292 AGACAATTGCATTCAAGGCCTGG + Intergenic
1064984392 10:21195537-21195559 AGACAGGTGCTTTCAATGACTGG + Intergenic
1069059017 10:63873903-63873925 AGGCACTTACTTTCAAGTACTGG - Intergenic
1070359085 10:75670031-75670053 AGACATTTGCTTTCAATGAATGG - Intronic
1071234918 10:83633950-83633972 AGACATTTACTTACAAAGACTGG + Intergenic
1072858967 10:98983110-98983132 AGACAATTTTTTCCAAGAACTGG + Intronic
1075212287 10:120501672-120501694 AAACCCTTGGATCCAAGGACAGG - Intronic
1075616158 10:123891935-123891957 GAACACCTGCCTCCAAGGACCGG - Intronic
1076487406 10:130833580-130833602 AGACGCCTACTTCTAAGGACCGG + Intergenic
1079833392 11:25300306-25300328 AGAAAATTGGTACCAAGGACTGG + Intergenic
1080819431 11:35791127-35791149 GGACACTTGCTCCCAAGCAGAGG - Intronic
1081784215 11:45735255-45735277 AGACAATGGCTTCAAAGGAAGGG + Intergenic
1082677799 11:56129905-56129927 AGTGACTTTCTTCAAAGGACTGG + Intergenic
1083086789 11:60156399-60156421 TGGCTCATGCTTCCAAGGACTGG - Intergenic
1084983026 11:72842491-72842513 AGACACTGGCAACCAAGGACCGG + Intronic
1088152497 11:106761791-106761813 TGACTCTTGCTTCCCTGGACAGG + Intronic
1089190978 11:116653123-116653145 AGACACTTCCTTCCTATGCCTGG - Intergenic
1090280778 11:125454338-125454360 AGACACTGGCTTACAGAGACAGG + Intronic
1091284061 11:134398330-134398352 AGCCACTGGGTGCCAAGGACAGG - Intronic
1091756668 12:3056836-3056858 AGAGACTTCCTTCCATGGAAAGG + Intergenic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1104797814 12:131531840-131531862 AGACAGGTGTTTCCAAGGAAAGG - Intergenic
1105617428 13:22031568-22031590 AGACACATGGTTCCAATGAGAGG - Intergenic
1105934285 13:25084963-25084985 AGACAACTGCTACCAAGGAAGGG - Intergenic
1106381406 13:29243459-29243481 TGACATTTGCTTTCAAAGACTGG + Intronic
1106878661 13:34105044-34105066 AGAGACTGGTTGCCAAGGACAGG + Intergenic
1107276169 13:38681791-38681813 AGATTCCTGATTCCAAGGACTGG - Intergenic
1113076009 13:106468594-106468616 AAACTCCTGCCTCCAAGGACAGG + Intergenic
1115733384 14:36296505-36296527 AGAGGCTTGCTTGCAGGGACTGG - Intergenic
1116095599 14:40363108-40363130 AAACAATTGCCTCCAAGCACAGG - Intergenic
1117967944 14:61224798-61224820 AGAAACTTGCTTCCAAAGAGTGG - Intronic
1118184712 14:63526473-63526495 AGAAAGTTGTTTCCCAGGACAGG - Intronic
1118910186 14:70055660-70055682 TGACAATTTCTCCCAAGGACTGG - Intronic
1121920686 14:97878319-97878341 ACTCACTTGCTTCCAAGACCAGG + Intergenic
1124603587 15:31153925-31153947 AGAGTCCTGCTTCCCAGGACTGG + Intronic
1125840966 15:42800990-42801012 AGACACTAGCTTCCCATCACGGG + Intronic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1132613171 16:827838-827860 AGACACTCGCTGCCAGGCACAGG + Intergenic
1134855183 16:17512657-17512679 AGCCAGTTGCTGTCAAGGACTGG + Intergenic
1135513493 16:23109587-23109609 AGTGACTTACTTCCAAAGACAGG + Intronic
1137737098 16:50732841-50732863 AGACATTTGCTTTGAAGGAACGG - Exonic
1137760992 16:50940223-50940245 AGACATTTCCTCCCAAGGAGAGG - Intergenic
1138449228 16:57083235-57083257 ACATACTAGCTTCCAAGGACAGG + Exonic
1140793810 16:78416563-78416585 AGGAACTTGCTACCAAAGACAGG - Intronic
1141153283 16:81579410-81579432 AGAAACTGGCTTCCGAGGTCTGG - Intronic
1142041837 16:87899254-87899276 AGACTCTTGCTCCCAAGGCTGGG + Intronic
1143668774 17:8382029-8382051 AGACTCTTGCTCCCAAAGAGTGG - Intronic
1144419979 17:15087687-15087709 AGAAACTTGGTTCTGAGGACTGG - Intergenic
1147260379 17:39206650-39206672 GGACACCTGCTTCCCAGGCCTGG + Intergenic
1147273335 17:39293363-39293385 AGACACATGCTACCACGGCCTGG + Intronic
1148167310 17:45492254-45492276 TGAAGCTTGCTTCCAAGAACTGG - Intergenic
1149293900 17:55243243-55243265 AGACACTTGCATGCTAGGAAAGG - Intergenic
1149677142 17:58476062-58476084 TGCAACTTGCTCCCAAGGACTGG + Intronic
1150398489 17:64838668-64838690 TGAAGCTTGCTTCCAAGAACTGG - Intergenic
1150657158 17:67046739-67046761 AGGCAGATGGTTCCAAGGACGGG - Intronic
1155715367 18:28936127-28936149 AGACACTTGCATGCAGGGTCAGG - Intergenic
1155866511 18:30972659-30972681 AGAAACGTGGATCCAAGGACAGG - Intergenic
1157206459 18:45704292-45704314 AGAAAATTGGTACCAAGGACTGG - Intergenic
1157784992 18:50473819-50473841 AGACAGATGTTGCCAAGGACAGG + Intergenic
1160442527 18:78903272-78903294 GGGCACTTGCTTCCAGGGAGTGG + Intergenic
1160451782 18:78971419-78971441 AGACACGTCCTTCCCAGGCCTGG - Intergenic
1162740211 19:12769828-12769850 AGAGACTTGCTGCCAGGGGCGGG + Intronic
1165696103 19:37902135-37902157 ACAAACTTGCTTTTAAGGACAGG - Intronic
1167223151 19:48216788-48216810 AGACAATTTTTTCCACGGACTGG + Intronic
1167254147 19:48417264-48417286 AGCCACTTGCTTCCACAGAGTGG - Intronic
1167667144 19:50829155-50829177 AGACACTTGCATACAGGGTCTGG + Intronic
928199021 2:29235212-29235234 AGTCACTTTCCTCCAAGGTCAGG - Intronic
928325094 2:30313101-30313123 CAACAGCTGCTTCCAAGGACAGG + Intronic
929175727 2:38973600-38973622 AAACAGTTGCTTCCTAGAACTGG - Intronic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
933430289 2:82168581-82168603 ACCCACTTGTTTCCAAGGAAAGG + Intergenic
936755895 2:115712009-115712031 AGACAATTTTTTCCATGGACTGG + Intronic
938584744 2:132679206-132679228 AGACACTTGTTTCCCAGCCCAGG - Intronic
939210839 2:139173224-139173246 AGGCACTTGCTTTTAAGGACTGG + Intergenic
943595607 2:189851576-189851598 AAACACTTATTTCCAAGGGCAGG + Intronic
944150314 2:196551294-196551316 ACACACTTACAGCCAAGGACAGG + Intronic
1169165209 20:3416859-3416881 AGAAAATTGTTACCAAGGACTGG - Intergenic
1170567305 20:17614496-17614518 AGACACTCGCTTCCCAGCAAGGG + Intronic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1172973486 20:38889933-38889955 ACACACTTGCTTTCATGGGCAGG - Intronic
1175632697 20:60555779-60555801 ACACACTTGATTCTAGGGACTGG + Intergenic
1175854156 20:62111075-62111097 AGACAATTGTTACCAAGGAGTGG + Intergenic
1177591838 21:23180783-23180805 AGTCACTGTCTTCCAAGCACTGG + Intergenic
1178971978 21:37187791-37187813 ATGCACCTGCTTCTAAGGACAGG + Intronic
1178983458 21:37283917-37283939 AGACATTTTTTTCCATGGACAGG - Intergenic
1179873970 21:44258222-44258244 AGGCACTTGCTCCTGAGGACTGG + Intronic
1180608694 22:17081661-17081683 AGACACTTGCCTGCCAGGAAAGG + Intergenic
1183687360 22:39368803-39368825 AGACACATGCTTCCGGGGGCTGG - Intronic
951035356 3:17926473-17926495 ACACACTTGCTTCCACCTACAGG - Intronic
951536482 3:23744963-23744985 ATACACTTGCATCCAAACACTGG - Intergenic
951605860 3:24434298-24434320 AGGCAGTTGCTTTCAAGAACAGG + Intronic
954432714 3:50479770-50479792 AGGCACTTGATTCCAAGCAGAGG - Intronic
954456502 3:50602523-50602545 AGAGAGTTGCTTCCATGGCCCGG - Intergenic
955075428 3:55608863-55608885 AGACACTGGCTTCCGAAGGCTGG + Intronic
959969886 3:112397587-112397609 AGACACTTGCTTCAGAGTCCAGG + Intergenic
962926001 3:139993933-139993955 AGAAAATAGCTCCCAAGGACTGG - Intronic
963847327 3:150172438-150172460 AGAGACTTCCTTCCAAAGACAGG + Intergenic
964721082 3:159767677-159767699 AGACACTTGCTTCCAAGCAGAGG - Intronic
967215681 3:187208129-187208151 AGAAAATTGCTACCAAGGAGTGG - Intergenic
974091018 4:57311601-57311623 AGACAATTTTTTCCATGGACAGG + Intergenic
976398949 4:84586208-84586230 AGACACTTTTTTCCACGGATGGG + Intronic
977107837 4:92911743-92911765 AGAGACTTGCTTTCAAGTATTGG + Intronic
979265749 4:118700862-118700884 AGACACTTCATTACAAGTACAGG + Intronic
981408749 4:144402743-144402765 AGAAACTTGCTTAAAAGAACAGG - Intergenic
983217620 4:165016841-165016863 AGACACATCCTTCCCAGCACAGG + Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
985674431 5:1223546-1223568 GGACATCTGCTTCCACGGACAGG + Exonic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
988545832 5:32156590-32156612 AGACAATTTTTTCCACGGACTGG + Intronic
989338557 5:40348582-40348604 AAGCACTTGCTTCCCATGACTGG - Intergenic
989625607 5:43426755-43426777 AGACAATTTTTTCCATGGACGGG + Intergenic
991145298 5:63295876-63295898 AGACAAGTGAATCCAAGGACTGG + Intergenic
993157179 5:84240676-84240698 AGACAATTTTTTCCATGGACCGG - Intronic
993809151 5:92453952-92453974 GGACACTTTCTTTCCAGGACTGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997308995 5:132864231-132864253 AGACATATGCTACCAAGGAAGGG - Exonic
999218278 5:149954321-149954343 AGATAGTTGCTTTCAAGGCCGGG + Intergenic
1000870638 5:166573099-166573121 AGGCAGTGGCTTCCAAAGACTGG + Intergenic
1001220666 5:169897718-169897740 AGACAAATGCTTGCATGGACAGG - Intronic
1004288513 6:14345520-14345542 AAACAGTTGTTTCCAAGGGCTGG - Intergenic
1007044894 6:38762942-38762964 AAACAGTTGATCCCAAGGACTGG + Intronic
1007723643 6:43900998-43901020 ACACACCTGCTTCCAGGCACTGG - Intergenic
1009019611 6:57936853-57936875 AGGCACTTGCTGGCAATGACAGG - Intergenic
1011166054 6:84447735-84447757 ACACAGTTGCTTCCAAGAAGGGG + Intergenic
1011934605 6:92759700-92759722 AGCCACTTTTTTCCACGGACTGG - Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1021931785 7:25588176-25588198 AGCCACTTGCTTCCAAATGCAGG + Intergenic
1029215222 7:98943336-98943358 AGACAGCAGCTGCCAAGGACAGG - Intronic
1029838880 7:103341767-103341789 AAACACTTGATCCCAAAGACTGG - Exonic
1031625759 7:123991271-123991293 TGACAAGTGCTTCCAAGGACTGG + Intergenic
1031787011 7:126045691-126045713 AGACAATTTTTTCCATGGACAGG - Intergenic
1033335209 7:140446510-140446532 AGACAATTTTTTCCATGGACAGG + Intergenic
1034408095 7:150919495-150919517 AGGGACTTGCTTCCAAAGAACGG - Intergenic
1034558875 7:151867072-151867094 TGACACTCCCTTCCAAGGTCTGG - Intronic
1037732687 8:21541516-21541538 AGAAAATTGCTGCCAAGGAGTGG - Intergenic
1038643719 8:29347513-29347535 AGGTGCTTGCTTCCAAGGGCAGG + Intronic
1038711725 8:29953176-29953198 AGATACATGATTCCAAGGAGAGG + Intergenic
1038857497 8:31349516-31349538 ACACATGTGCTTCCAAGGATGGG + Intergenic
1039124484 8:34185839-34185861 AGACATCTGGTTCCAAGGAAAGG + Intergenic
1039428226 8:37504679-37504701 AGACACTGGTTTGCAATGACAGG + Intergenic
1040317319 8:46271510-46271532 AGACACTCAGTTCCCAGGACAGG + Intergenic
1041819025 8:62008327-62008349 AGACTCTTTGTTCCAAGAACTGG + Intergenic
1043065679 8:75567612-75567634 ACACAGCTGCTTTCAAGGACTGG + Intergenic
1048734279 8:137481197-137481219 AGACACTTGATTCTAAGGTTTGG + Intergenic
1048996437 8:139796436-139796458 AGACACATGCATTCAAGGAGTGG - Intronic
1051665436 9:19463800-19463822 AGACACTTTTTTCCACAGACTGG + Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1057877582 9:98769638-98769660 AGGCACGTGGTTCCAAGAACAGG + Intronic
1058366281 9:104212943-104212965 ACATACTTACTTCCAAGGAAAGG - Intergenic
1060144006 9:121235416-121235438 AGCCACTGTCTTCCAAGGGCTGG + Intronic
1061508216 9:131044554-131044576 AGTGACTTGCTTCTAATGACTGG + Intronic
1061563011 9:131418539-131418561 AGTCACTTGCTGCCAGAGACAGG + Intronic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1061787198 9:133036844-133036866 GGACACTTGATACGAAGGACAGG - Intronic
1187236693 X:17474661-17474683 GGAAACTTGCATCCAAAGACTGG - Intronic
1187862013 X:23691898-23691920 AGACACCAGCTCCCAAGTACAGG + Intergenic