ID: 1020098062

View in Genome Browser
Species Human (GRCh38)
Location 7:5379547-5379569
Sequence CTGGTGACCATCCATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 213}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020098062_1020098067 -8 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098067 7:5379562-5379584 GTCACCAGAGGAGAGGGGACAGG No data
1020098062_1020098072 6 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098072 7:5379576-5379598 GGGGACAGGGAGCGGCGGAGTGG 0: 1
1: 0
2: 10
3: 153
4: 1075
1020098062_1020098070 -2 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098070 7:5379568-5379590 AGAGGAGAGGGGACAGGGAGCGG No data
1020098062_1020098073 10 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098073 7:5379580-5379602 ACAGGGAGCGGCGGAGTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 245
1020098062_1020098068 -7 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098068 7:5379563-5379585 TCACCAGAGGAGAGGGGACAGGG 0: 1
1: 0
2: 1
3: 41
4: 387
1020098062_1020098074 22 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098074 7:5379592-5379614 GGAGTGGCAGGAGCCCCGTCTGG No data
1020098062_1020098071 1 Left 1020098062 7:5379547-5379569 CCTGGCACATGGATGGTCACCAG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1020098071 7:5379571-5379593 GGAGAGGGGACAGGGAGCGGCGG 0: 1
1: 0
2: 18
3: 222
4: 1851

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020098062 Original CRISPR CTGGTGACCATCCATGTGCC AGG (reversed) Intronic
900952022 1:5863559-5863581 CTGGTTCCCATCCTTGTACCGGG - Intronic
901929034 1:12584811-12584833 CTGCTGAGCATCCCTGTGCCAGG + Intronic
902330358 1:15728283-15728305 CAGGTTGCCCTCCATGTGCCCGG - Exonic
902512168 1:16972461-16972483 CTGGAGAACACCCCTGTGCCTGG + Exonic
903354579 1:22738732-22738754 CTGAGGACCAACTATGTGCCTGG + Intronic
903466519 1:23555663-23555685 CTGGGGACCAAGCATGTGCCAGG + Intergenic
903487314 1:23699973-23699995 CTGGGGACCATGCTAGTGCCTGG + Intergenic
904162044 1:28529324-28529346 CAGGTGCCCATCACTGTGCCTGG + Intronic
904378566 1:30096524-30096546 CTGGTGACCACCCCTGCCCCTGG + Intergenic
905342674 1:37290013-37290035 CTTGTGACCAGCCAGGTGCCGGG - Intergenic
905842188 1:41191015-41191037 CTGGTGTGCATCAATGCGCCTGG + Intronic
911042422 1:93601151-93601173 CAAGCGAGCATCCATGTGCCAGG - Intronic
915604778 1:156943703-156943725 CTGCTGACCACCCCTGTGCCAGG + Intronic
916191214 1:162180172-162180194 CCGGTGACCTCCAATGTGCCAGG + Intronic
916674389 1:167053910-167053932 CTGGTGCCCCTCCAGGTGCTGGG + Exonic
919842096 1:201616920-201616942 CTGGGCACCTTCCATGTACCAGG - Intergenic
920288023 1:204895538-204895560 CTGATGACCATGTATGTGGCTGG + Intronic
921826267 1:219675206-219675228 ATGGAGGCCCTCCATGTGCCAGG - Intergenic
922975637 1:229781268-229781290 ATGGTGACCATCGATGAGCAGGG - Intergenic
924175431 1:241386750-241386772 CTGGTGAAGATTCATGAGCCTGG - Intergenic
924586719 1:245367066-245367088 CTGGAGCCCACCCACGTGCCGGG - Exonic
1063096827 10:2915792-2915814 CTGGGCACCATCCATGGCCCTGG + Intergenic
1065788748 10:29241093-29241115 CTGCTGACCATCTAACTGCCTGG + Intergenic
1067327597 10:45284571-45284593 ATGGTGACCAACCATGGGCCTGG + Intergenic
1068779254 10:60901976-60901998 CTGGGGCTCACCCATGTGCCAGG - Intronic
1069948941 10:72006353-72006375 CTGGACACCAACTATGTGCCAGG - Intronic
1070284044 10:75070871-75070893 CTGGTGACCATTCACGTTTCTGG - Intergenic
1070810079 10:79293224-79293246 CTGGTGACCAACCAGGCCCCAGG - Intronic
1072009803 10:91292775-91292797 CTGGAGACCTCCCATGGGCCAGG - Intergenic
1072168738 10:92839405-92839427 CTATTGACCATCCTTGTGCAAGG - Intronic
1072443969 10:95481645-95481667 CTGTTGCCCATGCATGTGACTGG + Intronic
1073552634 10:104417217-104417239 CTGGTGACCAGGCATGGGCCTGG + Intronic
1074657089 10:115603078-115603100 TTGGTGAACATCCACGTGCTGGG - Intronic
1076307590 10:129475951-129475973 CAGCTGACCAACCATTTGCCAGG + Intronic
1076726567 10:132416727-132416749 CTGACGACCATGCCTGTGCCGGG - Intronic
1080760156 11:35240885-35240907 TGACTGACCATCCATGTGCCAGG - Intergenic
1081567936 11:44271072-44271094 CTGGTGGCAAGCCAGGTGCCTGG - Intronic
1083641027 11:64145435-64145457 CTGGGGACTCTCCGTGTGCCAGG + Intronic
1084125271 11:67095149-67095171 CTGGTGTCCCTGCAGGTGCCTGG - Intergenic
1085461989 11:76699706-76699728 CTGGAGAGCATGCCTGTGCCTGG - Intergenic
1088516217 11:110637608-110637630 CTGGGTACCAGCCATGTGCCAGG + Intronic
1088589932 11:111394727-111394749 CTTGTGCCCAGCCCTGTGCCTGG + Intronic
1091145487 11:133275750-133275772 CTATTGAATATCCATGTGCCAGG - Intronic
1092179395 12:6435047-6435069 CTGGTGATCCTCCCTGTGGCGGG - Intergenic
1092905833 12:13099947-13099969 CTGATGACCATGCATGCCCCTGG + Intronic
1095049395 12:37543155-37543177 ATGGTGTCCAGGCATGTGCCCGG - Intergenic
1097187593 12:57204035-57204057 CGGGTTCCCATCCCTGTGCCTGG - Intronic
1099676541 12:85767843-85767865 CTAGTGAGCATCCTTGTTCCTGG - Intergenic
1100688537 12:97013112-97013134 CTGGTTACCATACCTGTGCCTGG + Intergenic
1100788507 12:98104920-98104942 CTGGTGAACAGCTATGTGACAGG - Intergenic
1101037873 12:100722718-100722740 CTGGTCACCTACTATGTGCCAGG - Intronic
1102506344 12:113386911-113386933 TGGGTGACCATCCTTGTCCCCGG + Intronic
1104105774 12:125657632-125657654 CTGGGGACCATGCATTTGCCTGG + Exonic
1104715906 12:131016041-131016063 CTGGTGTCGTTCCCTGTGCCTGG + Intronic
1105210261 13:18253211-18253233 CTGGCCCCCAGCCATGTGCCCGG + Intergenic
1106564410 13:30872264-30872286 CTGGTGAGCATGGCTGTGCCGGG + Intergenic
1106749947 13:32752431-32752453 CTTCTGATCATCTATGTGCCAGG + Intronic
1116106868 14:40519707-40519729 GTGGTGACCACCCATGTGGAGGG - Intergenic
1118477859 14:66135118-66135140 CTGGGGATCTTCCATCTGCCTGG + Intergenic
1120230299 14:81834435-81834457 CAGGTGTCCATCAAGGTGCCAGG - Intergenic
1122116188 14:99528466-99528488 CTGAAGACCTGCCATGTGCCCGG + Intronic
1122809276 14:104280070-104280092 CTGGTGTCCGTCCAGGTTCCAGG + Intergenic
1122901736 14:104784837-104784859 CTGGTGGCCCTCCACGTCCCGGG + Intronic
1122995722 14:105262754-105262776 CCTGGGGCCATCCATGTGCCTGG - Intronic
1123420361 15:20125771-20125793 CTGCTGACCAGCCCTGTGACTGG + Intergenic
1123445498 15:20327753-20327775 CTGCTGACCAGCCCTGTGACTGG - Intergenic
1123529585 15:21132307-21132329 CTGCTGACCAGCCCTGTGACTGG + Intergenic
1127060389 15:55176883-55176905 TTGAGGACCAACCATGTGCCAGG + Intergenic
1127100973 15:55564577-55564599 CTGGTGGCCATGCCTGTCCCAGG + Intronic
1128560728 15:68666240-68666262 CTGTTGACTTGCCATGTGCCAGG - Intronic
1129654009 15:77510755-77510777 CTGGTGGGCATCCCTGAGCCAGG + Intergenic
1129743485 15:78001787-78001809 CTGGAGTCCAGCCTTGTGCCTGG - Intronic
1130063210 15:80584281-80584303 CTGGTGTCCACCCATTTTCCAGG - Intronic
1131435502 15:92418499-92418521 CTTGAGCCCCTCCATGTGCCAGG - Intronic
1132220139 15:100099164-100099186 CTGGAGACCATCCAGGGGCTGGG + Intronic
1133221326 16:4320325-4320347 GTGGGGACCCTCCATGTGACGGG - Intronic
1134476890 16:14581776-14581798 CTGGTGTGCATCACTGTGCCTGG - Intronic
1135933401 16:26758842-26758864 CTGAACACCACCCATGTGCCTGG + Intergenic
1141926577 16:87173997-87174019 CTGGCGACACTCCATGTACCGGG - Intronic
1142130513 16:88429743-88429765 CTGGTGGCCATCCTTGGCCCTGG - Exonic
1143349531 17:6277306-6277328 CAGGTGAGCATCCATGGGCAAGG - Intergenic
1143431669 17:6892525-6892547 CTGGTGGACATCAAAGTGCCGGG - Intronic
1145771628 17:27497379-27497401 CTGGGCACCATCCTTGTCCCAGG - Intronic
1146168303 17:30610529-30610551 TTGTTGACCATTTATGTGCCAGG + Intergenic
1146221275 17:31024019-31024041 TTGTTGACCATTCATGTGCCAGG + Intergenic
1146561349 17:33872874-33872896 CTGGTGCCCATGCGTGGGCCAGG - Intronic
1147040376 17:37713751-37713773 CTGATGAGCAGCCTTGTGCCTGG - Intronic
1147390283 17:40105084-40105106 CAGGGAACCAGCCATGTGCCTGG + Intergenic
1147995084 17:44355829-44355851 ATGGTGACCAGCCCTGTGCCAGG + Exonic
1148721864 17:49759369-49759391 TTGCTGACCATGTATGTGCCTGG + Intronic
1148955331 17:51349134-51349156 CTGGGGACCTAGCATGTGCCTGG - Intergenic
1149419960 17:56500788-56500810 CTGGCCACCCTCTATGTGCCAGG + Intronic
1150574307 17:66416434-66416456 GTGGGGAGCATCCATGTGGCCGG + Intronic
1151714459 17:75824220-75824242 GTGGTCACCATCCATGGGTCTGG - Intronic
1152504826 17:80741895-80741917 CTGGTTACCCTCCAACTGCCTGG - Intronic
1154042183 18:10866689-10866711 CTGGTGACCAGGGATGTGGCTGG + Intronic
1155160460 18:23191106-23191128 CAGGTGCACATCCATGTGCCTGG - Intronic
1156507746 18:37609201-37609223 CTGGTGACCATCAAAGTGCCAGG - Intergenic
1157758219 18:50237592-50237614 CTGGTCACCCTCCCTGTTCCTGG - Intronic
1160938778 19:1610324-1610346 CTGGGGAGCATCCCTGGGCCTGG - Exonic
1161085806 19:2334355-2334377 CTGGTGACCATGAGTGTGTCAGG - Intronic
1161760455 19:6167366-6167388 TTGCTGACCTTCCATGGGCCAGG - Intronic
1162003928 19:7765247-7765269 CTGGTGGCCATCCTTGTCCAAGG + Exonic
1162179860 19:8860999-8861021 TTGGTGGACATCCATGTGACAGG - Exonic
1164291017 19:23868823-23868845 ATGGTGGCCAACCATGGGCCCGG + Intergenic
1165595596 19:37009427-37009449 CTGGTGTCCAGGCATGTGCCCGG - Intronic
1165837355 19:38767357-38767379 GTGGTCACCACCCAGGTGCCAGG + Intronic
1166324082 19:42038428-42038450 CTGGTCACTAGCCATGGGCCTGG + Intronic
1166688610 19:44810053-44810075 CTGTTGACCATGAGTGTGCCAGG - Intronic
927695123 2:25234618-25234640 CAGATCACCAACCATGTGCCAGG + Intronic
928877284 2:36054695-36054717 CTGGTATAAATCCATGTGCCTGG - Intergenic
932721263 2:74140451-74140473 CTGGGCTCCTTCCATGTGCCAGG + Intronic
933956522 2:87376922-87376944 CTGCTGACCAGCCCTGTGACTGG - Intergenic
934526857 2:95057352-95057374 CTGGTGGCCTTCCTTGTGCAGGG + Intergenic
936196109 2:110373647-110373669 CTGCTGACCAGCCCTGTGACTGG - Intergenic
937493710 2:122396443-122396465 CAGGTAACCCTCCATGTGGCAGG - Intergenic
938115657 2:128601638-128601660 CTAGGGACCATCCATGTGGATGG + Intergenic
938115669 2:128601703-128601725 CTGTGGACCCTCCAAGTGCCAGG - Intergenic
938977860 2:136496330-136496352 CTGGGCACCCACCATGTGCCTGG - Intergenic
939678688 2:145104142-145104164 CAGGTGGCCAACCATGGGCCTGG - Intergenic
941299089 2:163778475-163778497 CTGGCTACTAACCATGTGCCAGG - Intergenic
943337757 2:186639518-186639540 CTGGTGACCATGTATGAGTCTGG + Intronic
944993999 2:205272694-205272716 CTGCTGCCCCTCCATGTGCCAGG + Intronic
946819326 2:223613935-223613957 CTGGTGCCAAACCAGGTGCCTGG + Intergenic
948446691 2:238038830-238038852 CTGGTGACCACTTATGTGCCAGG + Intronic
948864901 2:240770288-240770310 CTGGTGCCCAGCAATGGGCCGGG - Intronic
1171291406 20:23984901-23984923 CTGGCCCCCAGCCATGTGCCTGG + Intergenic
1171543924 20:25986670-25986692 ATGGTGTCCAGGCATGTGCCCGG - Intergenic
1172215552 20:33233276-33233298 CTGGATCCCATACATGTGCCTGG - Intergenic
1172304440 20:33871236-33871258 CTGTTTACCAGCCCTGTGCCAGG - Intergenic
1172623400 20:36334081-36334103 CTGGTGCCCAGCCCTGTGCCTGG - Intronic
1172942390 20:38663499-38663521 CTGGTTATCTGCCATGTGCCAGG + Intergenic
1173671204 20:44800169-44800191 GTGGTGCCCATCCCTGTGCCAGG - Intronic
1173704084 20:45097515-45097537 CTGGTGTGCAGCCCTGTGCCTGG + Intronic
1173730113 20:45322391-45322413 CTGGTGACCTTTCATGTGTGAGG - Intergenic
1174528503 20:51192516-51192538 CTGGTGACCAAACCTGTCCCTGG + Intergenic
1174572565 20:51512475-51512497 CTGGGGACCTGCCATGTGCCAGG - Intronic
1175456124 20:59115847-59115869 CTGGTGTCCATCCATGTACGGGG + Intergenic
1176088557 20:63308998-63309020 CTGGCCACCATCCCTGTGCCTGG + Intronic
1176724356 21:10417844-10417866 CTGGTATCCATCCATGTCCTAGG + Intergenic
1177160942 21:17547262-17547284 CTGCAGCCCATCCATGTGACTGG - Intronic
1179150725 21:38806160-38806182 CGGGTGACCCTCCATGGGACTGG - Intronic
1180765992 22:18346192-18346214 CTGGCCCCCAGCCATGTGCCTGG - Intergenic
1181400550 22:22648034-22648056 CTGGCCCCCAGCCATGTGCCTGG - Intergenic
1181494307 22:23279398-23279420 CTGGTGACCCTCCTTGCTCCTGG + Intronic
1181702532 22:24629132-24629154 CTGGCCCCCAGCCATGTGCCTGG - Intergenic
1182070879 22:27462899-27462921 CTGATGAGCTTCCATGTGCAGGG + Intergenic
1182323155 22:29491439-29491461 CTGGGCACAAACCATGTGCCAGG + Intergenic
1183630564 22:39030113-39030135 CTGGTGTCCAGCACTGTGCCTGG + Intronic
1183634020 22:39050205-39050227 CTGGTGTCCAGCACTGTGCCTGG + Intronic
1184008579 22:41729522-41729544 CTGACCACCATCCTTGTGCCTGG + Intronic
1185323107 22:50210890-50210912 CTGGAGACCATGCATCTGACCGG + Exonic
949408888 3:3742516-3742538 ATTGGGACCAGCCATGTGCCAGG - Intronic
949917112 3:8973617-8973639 CAGGCGACCATCCCCGTGCCTGG - Intergenic
950452689 3:13074023-13074045 CCGAGGACCTTCCATGTGCCGGG + Intergenic
954392928 3:50276794-50276816 CCGGTGACCCCCAATGTGCCCGG - Intronic
954421276 3:50420293-50420315 CTGGGGTCCATCAATGTGGCAGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
966676384 3:182594690-182594712 CTGGCAAACATCCAGGTGCCAGG + Intergenic
968614265 4:1570344-1570366 CTGAGCACCCTCCATGTGCCTGG + Intergenic
969427402 4:7133354-7133376 CTGGTGATCTGCCATGAGCCTGG - Intergenic
971086041 4:23276121-23276143 CTGGTAACCATGCATGAACCAGG - Intergenic
972218587 4:36925980-36926002 CTTGTACCCATCCATGAGCCAGG + Intergenic
972359423 4:38313865-38313887 CTGATTACCTTCCCTGTGCCAGG - Intergenic
972974913 4:44622477-44622499 CTGCTGTCCTTCCATGTGCAAGG + Exonic
978567968 4:110104751-110104773 CTGGTGTCCAAGCAAGTGCCAGG - Intronic
978959104 4:114653911-114653933 CTGGTCACCTTCTATGTGCCAGG - Intronic
979400167 4:120239401-120239423 CTGGTTACTTTCCATGGGCCAGG - Intergenic
979440962 4:120749346-120749368 CTGTGGACTTTCCATGTGCCAGG - Intronic
980892292 4:138828965-138828987 CTGGTTACCCACCATATGCCAGG - Intergenic
981289839 4:143061709-143061731 CTAATGACCATCCTTGTGCAAGG - Intergenic
981423363 4:144576842-144576864 CTGGTGACCATGAATGTGGATGG - Intergenic
981933619 4:150215981-150216003 CTGGTTTTCATCCATGTTCCTGG - Intronic
982429681 4:155308569-155308591 CTGGGTACCTTCCATGTGCCAGG - Intergenic
989140367 5:38195631-38195653 CTGGTGACTAGCCCAGTGCCTGG - Intergenic
990044133 5:51408207-51408229 ATGGTTATCATCTATGTGCCAGG + Intergenic
990737658 5:58881424-58881446 CTGAGGACCTACCATGTGCCTGG - Intergenic
1001773806 5:174314095-174314117 CTGAGGGCCTTCCATGTGCCAGG - Intergenic
1005280996 6:24273671-24273693 CTGGGAACCATGCAAGTGCCTGG + Intronic
1006681372 6:35798915-35798937 CTGGGCACCCACCATGTGCCAGG - Intergenic
1007788361 6:44295017-44295039 TTGGGGACTGTCCATGTGCCCGG - Intronic
1007987563 6:46222654-46222676 CTGGTGATCATGCATGTCCTGGG + Exonic
1008537452 6:52517686-52517708 CTGGAGAGCAGCCATTTGCCTGG - Intronic
1012237105 6:96831761-96831783 CTGGTGCCGATCACTGTGCCTGG - Intronic
1013432809 6:110070142-110070164 CTGATCACCCACCATGTGCCAGG - Intergenic
1015372399 6:132469105-132469127 TTGAAGACCTTCCATGTGCCAGG - Intronic
1015650615 6:135454188-135454210 ATGGTGACCATCTATGGGTCTGG - Intronic
1017043372 6:150325278-150325300 CTGGAGCCCTTCCAGGTGCCGGG + Intergenic
1017254557 6:152318256-152318278 TTGGTGACCATCAAGGTGCTGGG - Exonic
1018886707 6:167944317-167944339 CTGGTGAGCTTCCATAGGCCCGG + Intronic
1019459937 7:1152434-1152456 CTGGCGTCCATCCCTGGGCCAGG - Intronic
1020098062 7:5379547-5379569 CTGGTGACCATCCATGTGCCAGG - Intronic
1020151575 7:5685700-5685722 CTGGTGACTTGCCATGTGGCTGG - Intronic
1022302856 7:29117792-29117814 TTGGGTACCAACCATGTGCCAGG - Intronic
1022839387 7:34148510-34148532 CTGCTGAGTATCTATGTGCCAGG - Intronic
1022948995 7:35317551-35317573 CTGCATACCATCCATGTGCCAGG + Intergenic
1023633135 7:42183371-42183393 CTGATGAACTTTCATGTGCCAGG + Intronic
1024707514 7:51976568-51976590 CAGGTGATCCTCCAAGTGCCAGG - Intergenic
1025249899 7:57344612-57344634 CTGGGGACCTACTATGTGCCAGG + Intergenic
1025295305 7:57771749-57771771 ATGGTGTCCAGGCATGTGCCCGG - Intergenic
1026568337 7:71508557-71508579 CTGCTAACCACCCATGGGCCGGG - Intronic
1027351940 7:77321074-77321096 CCTGTCACCAACCATGTGCCAGG + Intronic
1028586257 7:92454894-92454916 AAGGTGACCATCTATATGCCAGG - Intronic
1030375064 7:108745115-108745137 CTGGTGACCAGGCATGGGCAGGG + Intergenic
1033346065 7:140526452-140526474 ATGGTGACCATCCAGGCCCCTGG - Intronic
1037312884 8:17575318-17575340 ATGCTGACTATGCATGTGCCAGG - Intergenic
1044697885 8:94941469-94941491 CTGGTGACCACCATTATGCCAGG + Intronic
1047957301 8:129985489-129985511 ATGGTGACCCACCATGTGGCTGG + Intronic
1048426208 8:134326172-134326194 TTGGGTACCATCAATGTGCCAGG - Intergenic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1049375227 8:142286197-142286219 CTGGAACCCAGCCATGTGCCAGG - Intronic
1049450038 8:142655677-142655699 CTAGTGACCAGCCAGGTGTCAGG + Intergenic
1050119399 9:2292904-2292926 CTTGTGCCCAGCCATGTACCAGG + Intergenic
1051188303 9:14483654-14483676 CTGGGTAACTTCCATGTGCCGGG - Intergenic
1052340726 9:27361892-27361914 CTGGTGAGCTTCCATGAGACTGG - Intronic
1053036042 9:34827390-34827412 CTGGAGACCATCCATGGGGTGGG + Intergenic
1053419637 9:37969291-37969313 CTGCTGACCAGCCATGGGCTGGG + Intronic
1053522932 9:38799675-38799697 CAGGTGCCCACCAATGTGCCCGG + Intergenic
1053792951 9:41699708-41699730 ATGGTGTCCAGGCATGTGCCCGG + Intergenic
1054152226 9:61615117-61615139 ATGGTGTCCAGGCATGTGCCCGG - Intergenic
1054181362 9:61911729-61911751 ATGGTGTCCAGGCATGTGCCCGG + Intergenic
1054195158 9:62024096-62024118 CAGGTGCCCACCAATGTGCCCGG + Intergenic
1054471998 9:65546260-65546282 ATGGTGTCCAGGCATGTGCCCGG - Intergenic
1054643250 9:67564593-67564615 CAGGTGCCCACCAATGTGCCCGG - Intergenic
1055022595 9:71686112-71686134 CTGGTACCCATCCATGGCCCAGG - Intronic
1055840501 9:80497389-80497411 CTGGAGACCATCAATTTTCCTGG + Intergenic
1056961636 9:91129893-91129915 CTGGGCACCGGCCATGTGCCAGG + Intergenic
1060005232 9:119993647-119993669 CTGGTGAACACACATGTGCATGG - Intergenic
1060043953 9:120325458-120325480 CTGGTGGCCACTAATGTGCCTGG - Intergenic
1060325254 9:122608456-122608478 CTGGTGCTCATCCTTGTGGCAGG + Intergenic
1061790367 9:133055896-133055918 CTGGTGACCAGCCAGCTCCCTGG + Intronic
1061927423 9:133812706-133812728 CGGGTCACCCTCCATGTACCCGG - Intronic
1185880135 X:3733298-3733320 CTCGTGGCCATCCAGGTGCCTGG - Intergenic
1187853921 X:23618502-23618524 CTGGTGTCCATCAATCTGCAGGG + Intergenic
1189383554 X:40518839-40518861 CAGGTGACCTTCCATGTGTCTGG + Intergenic
1190722300 X:53159733-53159755 ATGGTGGCCAACCATGAGCCCGG - Intergenic
1197791758 X:130261955-130261977 CAGGTGAACATCACTGTGCCTGG + Intronic
1198374607 X:136026492-136026514 CTGAACACCAGCCATGTGCCGGG + Intronic
1199661818 X:150058361-150058383 CTGGCCACCAGCCATGTGCATGG + Intergenic
1201237160 Y:11922630-11922652 CTGGTGAGCATGAATGTGCAGGG - Intergenic