ID: 1020098436

View in Genome Browser
Species Human (GRCh38)
Location 7:5381129-5381151
Sequence CTTGAGGCCCTGAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020098436_1020098448 11 Left 1020098436 7:5381129-5381151 CCTGCCACCCTCAGGGCCTCAAG 0: 1
1: 0
2: 4
3: 21
4: 369
Right 1020098448 7:5381163-5381185 CAGGTTGCTCCCTGCAAATGTGG No data
1020098436_1020098442 -8 Left 1020098436 7:5381129-5381151 CCTGCCACCCTCAGGGCCTCAAG 0: 1
1: 0
2: 4
3: 21
4: 369
Right 1020098442 7:5381144-5381166 GCCTCAAGGGCCACAGCCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 303
1020098436_1020098449 15 Left 1020098436 7:5381129-5381151 CCTGCCACCCTCAGGGCCTCAAG 0: 1
1: 0
2: 4
3: 21
4: 369
Right 1020098449 7:5381167-5381189 TTGCTCCCTGCAAATGTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020098436 Original CRISPR CTTGAGGCCCTGAGGGTGGC AGG (reversed) Intronic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900646866 1:3712978-3713000 CTGGGGGCCCTGAGGGTCACAGG - Intronic
900661241 1:3785087-3785109 CTTGAGGTCCTGTGGGGGCCGGG + Exonic
901061189 1:6472657-6472679 CTGGAGCACCTTAGGGTGGCCGG + Intronic
901457028 1:9368829-9368851 CTTGAGGCTCTGAGAGGGGTTGG - Exonic
901644716 1:10710236-10710258 CTTGAGGCCCTGACTGGGGAAGG - Intronic
901652480 1:10751252-10751274 TTAGAGGCCCTGAGGGGGTCTGG + Intronic
902037105 1:13466035-13466057 CCTGAGAACCTGAGGGTCGCTGG + Intergenic
902410223 1:16207841-16207863 CCTGAGGCCGTCAGGGTGCCTGG - Intronic
903742100 1:25564176-25564198 CCTGAGTCCCTGAGGGAGTCAGG - Intronic
904482319 1:30801743-30801765 CATGAGGCCCTGTGTGGGGCAGG - Intergenic
905364035 1:37439130-37439152 CTTGTGGTCCTGGAGGTGGCAGG - Intergenic
905569341 1:38991475-38991497 CCTGAGGCCCGGAGTGGGGCCGG - Exonic
906117616 1:43366814-43366836 CTTCAGGCCCTGAGGGGGAGGGG - Intronic
906476200 1:46171268-46171290 CTTCAGTACCTGAGGGTAGCAGG + Intronic
906895217 1:49763703-49763725 CTGGAGGCCCTGGGGGAGTCAGG - Intronic
907283767 1:53367682-53367704 CTTGAGTCCCTGAGAGCTGCTGG + Intergenic
907451213 1:54547151-54547173 CGAGAGGCCCTGAGGATGGAAGG + Intronic
912023569 1:105138445-105138467 CTTCAGCCCCTGAGGGTCCCAGG - Intergenic
912221649 1:107684525-107684547 TTTGAGGCCCTTAGGAAGGCTGG - Intronic
912691909 1:111810983-111811005 CCTGAGGCCCTGAAGCTGGAGGG - Intronic
913345254 1:117802803-117802825 CTTGCAGCCCTGAGTGTGGGTGG - Intergenic
915108954 1:153550802-153550824 CTTGAAGTCTTGTGGGTGGCAGG + Intergenic
915286641 1:154857471-154857493 CCTGAGGCTCTGGGGGAGGCTGG + Intronic
918165095 1:181937334-181937356 CTTGTGTCCTTGAGGGTGGAAGG + Intergenic
919020249 1:192095554-192095576 CTTGATGCCCTGAGTGAGGGAGG + Intergenic
919550104 1:198975186-198975208 CCTGAGGCCCTGAAGGGGACAGG + Intergenic
919752990 1:201049715-201049737 AATGAGGACCTGTGGGTGGCTGG + Intronic
920342506 1:205284400-205284422 CCTGGGGCCCTGAGGGAGGGTGG + Intergenic
920400016 1:205670570-205670592 CTCCAGGCCCTGGGGGAGGCAGG - Intronic
922764484 1:228150091-228150113 CTTGAGGCCCCGAAGGAGGGAGG + Intronic
922940707 1:229462830-229462852 CATGAGCCACTGAGGCTGGCTGG + Intronic
924112170 1:240711116-240711138 ATGGAGGCGCTCAGGGTGGCAGG - Intergenic
924381817 1:243472336-243472358 CTTGAGTCCCTGAGAGTAGCTGG + Intronic
924769305 1:247064914-247064936 CTTGAGAGGCTGAGGGAGGCAGG - Intronic
1063543735 10:6960540-6960562 CATGAGCCCTTGAGGGGGGCTGG - Intergenic
1064122901 10:12634847-12634869 TTTGAGGTCATGATGGTGGCCGG + Intronic
1064213884 10:13383570-13383592 CAGGAGGACCTGAGAGTGGCCGG + Intergenic
1067444420 10:46331731-46331753 CTAGAGCCCCTGGGGGTGGACGG + Intergenic
1069384152 10:67869304-67869326 CATGAGCCCCTGAGCCTGGCTGG + Intergenic
1069724156 10:70566751-70566773 CGTGGGGCCCTGTGGGTGGGGGG - Exonic
1069835158 10:71303585-71303607 CTTGAGGTCCACAGGGTGGAGGG - Intergenic
1069949606 10:72009888-72009910 CCTGAGGGCTTGAGGGAGGCTGG + Exonic
1070600296 10:77861549-77861571 CATGAGGACCTGGGCGTGGCTGG + Intronic
1070664541 10:78333839-78333861 CTTAGGGCCCTGAGGAAGGCTGG + Intergenic
1071454214 10:85831274-85831296 CTTGAGTACATGAGGGTGGAGGG + Intronic
1073788930 10:106920195-106920217 CTTGAGTCCCAGTGGGTGGGCGG - Intronic
1075513105 10:123088048-123088070 CTTGGGGCCCTGAGGGTAGTGGG - Intergenic
1075654731 10:124153344-124153366 CTGGTGGCCCTGAGTGTGGTGGG + Intergenic
1075789397 10:125072702-125072724 CTTGGGGCCCTCATGGTAGCTGG + Intronic
1076478331 10:130767744-130767766 GCTGAGGCCGTGAGGGTGGGGGG + Intergenic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1076777240 10:132704618-132704640 CTTGAGGCCCTGGGTGCTGCTGG + Intronic
1077105580 11:841039-841061 CTGGAGGTCTTGAGGGTGACTGG - Intronic
1077233856 11:1470598-1470620 TTGTAGGCCCTGAGGGTGGCAGG - Intronic
1079434946 11:20438404-20438426 ATTTGGGCCCTAAGGGTGGCAGG + Intronic
1081991052 11:47337825-47337847 CTCAAGGCCCTGAGCGGGGCAGG - Intronic
1083307382 11:61768493-61768515 CATGAGGCCCCGAAGGTGGGTGG + Intronic
1083420025 11:62547157-62547179 CTGGGGGCTCTGAAGGTGGCTGG + Intronic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1083635088 11:64116554-64116576 CTTGAGGTCCTGGGGGATGCCGG - Exonic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1084171070 11:67401377-67401399 CCCGAGGCGCTGAGGGTAGCTGG - Intronic
1084207562 11:67604832-67604854 CTTGTGGCCTGGAGGCTGGCTGG + Exonic
1084426266 11:69086011-69086033 CTGGACGCCCGGAGCGTGGCTGG + Intronic
1084475571 11:69386816-69386838 TTAGAGGACATGAGGGTGGCTGG - Intergenic
1084484375 11:69439289-69439311 CTGGAGGCCTTGGGGGTGGAGGG - Intergenic
1084553753 11:69864069-69864091 CTTGTGGCTCTGCAGGTGGCGGG - Intergenic
1085689102 11:78651233-78651255 CCTGAGGACCTGGGGCTGGCGGG + Intergenic
1087044503 11:93833469-93833491 CTTGAGTGGCTGAGGGTGGGAGG + Intronic
1089204477 11:116748455-116748477 CCTGAGGCTGTGGGGGTGGCTGG - Exonic
1089248112 11:117137327-117137349 CCTGAGCCCCTTTGGGTGGCAGG + Intergenic
1089258601 11:117207234-117207256 CCTGAGCCCCTTTGGGTGGCAGG - Intronic
1091360390 11:134974739-134974761 CCGGTGGCCCTGGGGGTGGCTGG - Intergenic
1091408010 12:220982-221004 AGTGAGGTCCTGGGGGTGGCGGG + Exonic
1091565572 12:1645728-1645750 GAAGAGGCCCAGAGGGTGGCTGG - Intronic
1091603352 12:1930898-1930920 CCTGTGGCCCTGAGGGGAGCTGG - Intergenic
1091650609 12:2306320-2306342 GATCAGGCCCTGAGGGTGGAAGG - Intronic
1091764070 12:3106931-3106953 CTTGGGGCCCTGGGGATGGAGGG + Intronic
1091774445 12:3175280-3175302 CTTGAGGACATCAGGGTGTCTGG + Intronic
1091986362 12:4912295-4912317 CTGGAGGCCCTTAGAGTGGCGGG - Exonic
1092019442 12:5188642-5188664 CCTGAGGCCTGGTGGGTGGCTGG + Intergenic
1096216147 12:49798424-49798446 CTGGTGGCTCTGATGGTGGCTGG + Exonic
1096529781 12:52235284-52235306 CTTGAGGCACTGCAGGTGGATGG + Exonic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097308161 12:58091492-58091514 TTTGTGGCCCTGGGGGTGGGGGG + Intergenic
1097706074 12:62869744-62869766 CTTGAGGCTGTGATGGAGGCAGG - Intronic
1101560938 12:105857393-105857415 CTTCAGGGCCTGGGGGTGGGAGG + Intergenic
1101731661 12:107431919-107431941 ATTGAGGCCCTGAGTTTGGAGGG + Intronic
1102217195 12:111169883-111169905 CCAGAGGGCATGAGGGTGGCAGG + Intronic
1103894905 12:124266535-124266557 CATGCGGCCCTGAGGGTCTCAGG + Intronic
1103907398 12:124334750-124334772 ACGGAGGCCCAGAGGGTGGCGGG - Intronic
1103935623 12:124475011-124475033 ACAGAGGCCCTGAGGATGGCAGG - Intronic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1106362926 13:29049329-29049351 CATGAGGCCCTTAGGATAGCGGG + Intronic
1106550100 13:30763626-30763648 CTTGATGGCCTGAAGATGGCAGG - Intronic
1106813851 13:33386347-33386369 CTGGAGCCCCTGAGGAAGGCAGG - Intergenic
1107241628 13:38241835-38241857 CTTGAGGCACTGTGCTTGGCTGG + Intergenic
1108496100 13:51026805-51026827 CTGGAGGGCCTGCAGGTGGCAGG + Intergenic
1108720696 13:53128579-53128601 CTTGTGACCATGAGGATGGCTGG + Intergenic
1111710354 13:91804743-91804765 CTTGAGTCCCTAAGAGAGGCAGG + Intronic
1112849241 13:103684395-103684417 CTTGGGTCCCTGAGTGTGGTTGG - Intergenic
1113122275 13:106936221-106936243 CTTGAGGCAGGGAGGGTGGGAGG + Intergenic
1113150457 13:107257663-107257685 CTGGAGGCCCTGAGGTGGCCAGG + Intronic
1113868530 13:113544307-113544329 CTTTAGGCCCTGAGTGAGGAAGG + Intronic
1113932349 13:113975044-113975066 CCTGAGGTCCTGAGGGTCACAGG + Intergenic
1113959121 13:114116025-114116047 GTTGAGGCCTGGAGGGTGACAGG + Intronic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1116365101 14:44050407-44050429 GTTGAGACCCGGAGAGTGGCTGG - Intergenic
1118571780 14:67201431-67201453 TGTGAGGCCCTGAGGGGAGCTGG - Intronic
1118729967 14:68659223-68659245 CGTGAGGCCCTGGGGCCGGCTGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1121462525 14:94092911-94092933 CTTGAACCCAGGAGGGTGGCTGG - Intronic
1121777200 14:96598544-96598566 CATGAGGGGCTGTGGGTGGCGGG - Intergenic
1121874595 14:97439904-97439926 CTTTAGGCCTTGGGGCTGGCAGG + Intergenic
1122097809 14:99384231-99384253 ATTCAGGCCCAGAGGGAGGCGGG + Intergenic
1122636390 14:103131748-103131770 CATGAGGACCTGAAGGTAGCGGG + Exonic
1122794667 14:104200157-104200179 CTGGAGGCCGTGGGGGTGTCTGG + Intergenic
1123406254 15:20020907-20020929 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1123515584 15:21027555-21027577 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1123626096 15:22227761-22227783 CCTGAGGGCCTGGGGGTGTCAGG + Intergenic
1123911936 15:24976911-24976933 CTGGAGGCCCTGGGGTTGGTAGG + Exonic
1124985636 15:34609568-34609590 CTTGAGTCCCTAAGAGAGGCAGG + Intergenic
1128147017 15:65337495-65337517 CTTGGGGCCCTGGGGGTGGGAGG + Intronic
1128305813 15:66598286-66598308 CTTGAAAGCCTGAGGGTGGAAGG + Intronic
1128636758 15:69307541-69307563 GATGAGGCCCTGAGGGTAGGAGG + Intronic
1129273520 15:74431749-74431771 CTGGTGGCCCTGGGGGTGGGGGG + Intronic
1129514445 15:76148466-76148488 ATTGAGGACTTCAGGGTGGCGGG + Intronic
1129516923 15:76162696-76162718 TTGGAGGCCCTGAAGCTGGCAGG + Intronic
1130153720 15:81332263-81332285 GCTGAGGCCCTGAGGCTGACAGG - Exonic
1130555695 15:84921028-84921050 ACTGAGACCCTGAGTGTGGCTGG + Exonic
1130963250 15:88678954-88678976 CTGGAGTGCCTGCGGGTGGCAGG - Intergenic
1131149733 15:90039716-90039738 CTGGAGGCTATGATGGTGGCTGG - Intronic
1131315488 15:91333107-91333129 CTTGTGCCCCTGAGGTTGGTTGG + Intergenic
1131853088 15:96563565-96563587 CTTTAGCCCCAGAGGTTGGCTGG + Intergenic
1132400220 15:101500583-101500605 CTGGAGTTCCTGTGGGTGGCAGG - Intronic
1132989336 16:2785014-2785036 CTTGTGGCCCTGGGGGTAGCCGG + Exonic
1133607948 16:7406453-7406475 CCTGTGGCCCAGAGGGTGGATGG + Intronic
1134346172 16:13393770-13393792 CTTGAAGGCTTGAAGGTGGCTGG + Intergenic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1135031835 16:19044831-19044853 GATGAGGCCCTCAGGGTGGCTGG - Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1136247037 16:28982076-28982098 CTGGGGGGCCTGCGGGTGGCAGG + Intronic
1136398364 16:30005056-30005078 CTCGAGGGGCTGAGGGGGGCAGG + Intronic
1137248145 16:46722097-46722119 TCTGAGGCCCTGAGGGAGTCTGG + Intronic
1138438896 16:57022599-57022621 GATGAGGCCCTGCGGGTTGCGGG - Intronic
1139581607 16:67877115-67877137 CTTGAGACTCTGGTGGTGGCAGG + Intronic
1139602233 16:67993691-67993713 CATGTGGCCCTGGGTGTGGCCGG - Exonic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1140092656 16:71850743-71850765 CTTGAGGTCCAGCGGGTGGTTGG + Exonic
1140274180 16:73494054-73494076 CAAGAGGCCCTGAGGGAGACCGG - Intergenic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1140470801 16:75213278-75213300 CCTGAGGCCCTGAGTGCTGCGGG - Intergenic
1140578432 16:76200061-76200083 GTTGAGGCCCTGAGGGTGTCAGG + Intergenic
1141658841 16:85430774-85430796 CTCCAGGCCCTGATGGAGGCGGG - Intergenic
1142126704 16:88414132-88414154 ATCTAGGCCCTGAGGGTGACAGG - Intergenic
1142335837 16:89489699-89489721 CTTGGGGACCTGAGGCTGCCGGG - Intronic
1142966815 17:3586844-3586866 CTCGATGGCCTGAGGGAGGCTGG - Intronic
1143106101 17:4531330-4531352 CTGGGGGCCCCGAGGGCGGCGGG - Intronic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1144449495 17:15364398-15364420 CTGGAGCCCCTGAGTGTGGGTGG - Intergenic
1144708170 17:17383759-17383781 CTGGAGGAGCTCAGGGTGGCCGG - Intergenic
1144807680 17:17978540-17978562 CTTGGGGCCCCTAGGCTGGCCGG + Intronic
1145175675 17:20698758-20698780 TATGGGGCTCTGAGGGTGGCAGG - Intergenic
1146846468 17:36184212-36184234 CTGGAGGGCCTGGGGGAGGCTGG + Intronic
1147006945 17:37410950-37410972 TATGGGGCACTGAGGGTGGCAGG - Intronic
1147324180 17:39662557-39662579 CCTGAGGCCCTGAGGAAGGGTGG + Intronic
1148603171 17:48908991-48909013 CTTGCGGGTCTGAGGGTGGGGGG - Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148930283 17:51121793-51121815 CTTGAGGAGAGGAGGGTGGCTGG - Intergenic
1149849815 17:60027605-60027627 CTGGAGGGCCTGGGGGAGGCTGG + Intergenic
1149860353 17:60118919-60118941 CTGGAGGGCCTGGGGGAGGCTGG - Intergenic
1150444333 17:65216963-65216985 CTTGAGGGCCAGAGAGTGGATGG + Intronic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151852859 17:76701289-76701311 CTTCAGGGCGTGAGGGAGGCGGG + Intronic
1152644597 17:81463001-81463023 CCTGGGGCCCCGAGGGGGGCTGG - Intronic
1152654811 17:81514629-81514651 GCTCAGGCCCTGCGGGTGGCGGG - Intronic
1152800456 17:82328413-82328435 CTGGATCCCCTGAGAGTGGCTGG + Intronic
1152809708 17:82375666-82375688 CTGGAGACCCTCAGGGAGGCGGG - Intergenic
1152991250 18:365828-365850 CTTGAGGCCGGGAGGGGCGCTGG + Intronic
1153469749 18:5430643-5430665 CTTGAGCCCCTGGAGGTGGAGGG - Intronic
1153703288 18:7717941-7717963 CTTGAGGAGTTGAGAGTGGCGGG + Intronic
1153754080 18:8262498-8262520 CTGGAGGCCTGGAGGATGGCAGG - Intronic
1154494741 18:14947255-14947277 CTGGTGGCCCTGGGGGTGGCTGG + Intergenic
1155164109 18:23218853-23218875 ATTAAGGCCCTGATGGAGGCTGG + Intronic
1156432742 18:37092902-37092924 ATTCAGGCACTGAGAGTGGCAGG - Intronic
1157294927 18:46435539-46435561 CATCTGGCCCAGAGGGTGGCTGG - Intronic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1160409726 18:78667648-78667670 GATGAGGCCCTGAGGGCTGCTGG + Intergenic
1160753666 19:747173-747195 TAGGAGGCCCAGAGGGTGGCAGG - Exonic
1160754585 19:750909-750931 CTGGAGGCCCTGGGGGTGGAGGG + Intergenic
1160966869 19:1750522-1750544 CTCCAAGCCCTGAGGTTGGCAGG + Intergenic
1161685069 19:5698509-5698531 CTTCTGGGCCTGAGGCTGGCCGG + Intronic
1161803294 19:6427493-6427515 CTTCAGCACCTGAGGATGGCGGG + Exonic
1162506908 19:11090823-11090845 ACCGAGGCCTTGAGGGTGGCCGG - Intronic
1162747533 19:12807058-12807080 CTGGAGGCGCTGAAAGTGGCAGG + Exonic
1163201098 19:15769784-15769806 ATTGAGGCCCTCAGGGAGGATGG + Intergenic
1163271916 19:16259630-16259652 GTTGAGGCCCAGAGAGGGGCAGG + Intergenic
1163753367 19:19091963-19091985 CTTGAGACAGGGAGGGTGGCGGG + Intronic
1163849829 19:19656582-19656604 GTGGAGGCCCAGGGGGTGGCGGG - Intronic
1165286568 19:34847615-34847637 CTAGAGGAGCTGAGAGTGGCTGG - Intergenic
1165431681 19:35776487-35776509 GGTGAGACCCTGAGGGTGACTGG + Intronic
1165782534 19:38442589-38442611 ATTGAGGGCCTGTGGGGGGCAGG - Intronic
1165935428 19:39385783-39385805 CTTGAGCACCTGGGGGTTGCGGG + Intergenic
1166120982 19:40686718-40686740 CTTGAGGCTGTAAGGGTGTCAGG + Intronic
1166786491 19:45370337-45370359 CCTGAGGACCTGAGGGTTACCGG - Intronic
1166992116 19:46698902-46698924 CTTGAGGGATTGGGGGTGGCGGG - Intronic
1167171615 19:47836172-47836194 TGTGAGGCCCTGAGGCTGGGTGG - Intronic
1167708878 19:51098383-51098405 CTTCAGGCTCTGAGGGAGGAGGG - Exonic
1167741475 19:51326990-51327012 CTTACGGGCCTGAGGGAGGCGGG + Intronic
1168423006 19:56217529-56217551 CTGGAGGAGCTCAGGGTGGCCGG - Intergenic
925640401 2:5981428-5981450 CTTCAGGCGCTGAAGGAGGCAGG + Intergenic
926168090 2:10534169-10534191 CATGAAGCCCTGGGTGTGGCTGG - Intergenic
926789694 2:16557405-16557427 CGTGAGGGCCTGAGAGAGGCAGG - Intronic
927031690 2:19126598-19126620 CTTTAGCCCCTGAGGATTGCAGG - Intergenic
928415143 2:31085634-31085656 CATGAGCCCCTGAGGGTGGAGGG - Intronic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
935920010 2:108002456-108002478 CTAGAGGCCCTAAGTGAGGCAGG + Intronic
936011308 2:108927005-108927027 CATGAGCCCCTGAGAGGGGCTGG + Intronic
937230751 2:120396858-120396880 CTCCTGGCCCTGAGGGTGGTTGG + Intergenic
937880610 2:126861722-126861744 CCTGAGAACCTGAGGGTCGCTGG + Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
942824107 2:180153306-180153328 CTTGAGGGCTTGAGGGTAGAAGG - Intergenic
944146227 2:196510236-196510258 CCTAAGGGCCTGATGGTGGCGGG - Intronic
948772596 2:240259157-240259179 CCTGAGGCCCTGAGGGAGAATGG + Intergenic
948808539 2:240463296-240463318 CCCGAGGCCCTGGGGGTGCCTGG - Intronic
948941660 2:241199909-241199931 CCTGAGGCCCTGAGAGGGGAAGG + Intronic
1169465446 20:5834168-5834190 CTGGAGGCCGGGAGGGTGTCAGG + Intronic
1170570059 20:17627532-17627554 ATTGAGGCCCTGCTGGAGGCGGG - Exonic
1170596456 20:17809587-17809609 CTTCAGGGCCTGAGGCTTGCAGG - Intergenic
1171456784 20:25276782-25276804 CTTGTGTCCATGTGGGTGGCTGG + Intronic
1172170049 20:32924795-32924817 TTTGAGGCACTGTGGCTGGCAGG + Intronic
1172177324 20:32980299-32980321 CTGGCGGCCCTGTGGGTGGTTGG + Intergenic
1173832433 20:46099770-46099792 CTGGAGGAGCTCAGGGTGGCCGG + Intergenic
1173861610 20:46287526-46287548 GTAGAGGCCCTGAGGCTGGATGG + Intronic
1173867842 20:46323870-46323892 CCTCTGGCCCTGAGGGTGGGGGG + Intergenic
1174045038 20:47727377-47727399 CTTGAGTTCCTGGGGGTTGCTGG - Intronic
1174390716 20:50216831-50216853 CTGGGGGCCATGAGGGTGCCTGG + Intergenic
1174401445 20:50278103-50278125 CTTGAGGCCTGGAGGGTGGAGGG + Intergenic
1175294756 20:57900605-57900627 CTCGAGGCCCTGTGGGTGAAGGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175944900 20:62554110-62554132 CCTGGGCCCCTGGGGGTGGCTGG + Intronic
1176008050 20:62876842-62876864 CTTGTGGGCCTGTGGGTGCCAGG + Intergenic
1176048158 20:63103189-63103211 GTTGGGGCCCTGAGCGAGGCTGG - Intergenic
1176091528 20:63320553-63320575 CTGGAGGCCCTGGGGCAGGCTGG + Intronic
1176109531 20:63405101-63405123 CCTGAGGCCCTGAGGCCAGCAGG - Intergenic
1176120633 20:63453062-63453084 CTTGTGGTCTTGGGGGTGGCGGG - Intronic
1176184216 20:63769311-63769333 CCTGTGGCTCTGAGGGTGGAGGG + Intronic
1176218372 20:63958692-63958714 TTTGTGGCCCTGAGGACGGCTGG - Exonic
1176375923 21:6086820-6086842 CTGGTGGCCCTCGGGGTGGCGGG - Intergenic
1177419273 21:20835052-20835074 CTTGAGTACTTGAGGGTGGAAGG - Intergenic
1177450397 21:21258562-21258584 CCTTAGGTCCTGAGGGTGGAGGG - Intronic
1177828178 21:26107033-26107055 TTGCAGACCCTGAGGGTGGCGGG + Intronic
1179270972 21:39850759-39850781 CTTGAGGCTGTGGAGGTGGCTGG + Intergenic
1179747552 21:43451424-43451446 CTGGTGGCCCTCGGGGTGGCGGG + Intergenic
1179929426 21:44557599-44557621 CTGGAGACGCTGAGGCTGGCAGG + Intronic
1180079542 21:45480506-45480528 CTGGAGGCCCTGCGGGTGAGTGG + Exonic
1180127571 21:45802690-45802712 GGAGAGGCCCTGAGGGAGGCAGG + Intronic
1180955511 22:19739588-19739610 CCTCAGGGCCTGCGGGTGGCTGG + Intergenic
1181484272 22:23220556-23220578 TCTGAGGCCCTGAGGCTGCCTGG + Intronic
1182134006 22:27883705-27883727 TTAGAGCCCCTGAGGGTCGCTGG - Intronic
1182529615 22:30945081-30945103 CTTAAGGCCCTGAGGGCTGTGGG - Intronic
1182954276 22:34406664-34406686 CTTGGGGCTCTGATGGAGGCTGG + Intergenic
1183322699 22:37174852-37174874 CCTGTGGCCCTGAGGGAAGCTGG + Intronic
1184103486 22:42353974-42353996 GCTGAGGCCCTTAGGGAGGCTGG - Intergenic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184458694 22:44625338-44625360 CTGGAGACCCTGTGGCTGGCAGG - Intergenic
1184852138 22:47127040-47127062 CCTGAGACCCCGAGGGTGGGTGG - Intronic
1185300094 22:50075089-50075111 GTTGCGGCCCTGATGGTGCCGGG - Intronic
1185370402 22:50458367-50458389 CTTGAGCCCCTGAGCATTGCTGG + Intronic
1185408517 22:50671258-50671280 CCTGAGGTCCTGAAGGTGGGTGG + Intergenic
950188514 3:10960263-10960285 GAAGAGGCCCTGAGGCTGGCAGG - Intergenic
950971680 3:17195384-17195406 CTGGAGGCCCTGGTGCTGGCTGG - Intronic
952740840 3:36733016-36733038 CTGGTGTCCCTAAGGGTGGCAGG - Intronic
952769079 3:36981135-36981157 CTTGAGGGCCTGAAAGTGGGAGG - Intergenic
953717066 3:45324646-45324668 CATGAGGCACAGAGGGTGGGTGG - Intergenic
954155540 3:48683004-48683026 CTCCAGGCCCTGGGGGGGGCAGG + Exonic
954195472 3:48994298-48994320 CTTGGGTCCCTGAAGCTGGCAGG - Intronic
954416281 3:50394984-50395006 ACTTAGGCCCAGAGGGTGGCCGG - Intronic
954628579 3:52036119-52036141 CTGGTGACCCTGCGGGTGGCTGG - Intergenic
954681536 3:52348753-52348775 CCTGAAGCCTAGAGGGTGGCAGG - Intronic
954685973 3:52370463-52370485 CTTGAGGCCCTGGGGATGAAGGG - Exonic
954692740 3:52404317-52404339 TTTGGGGCCCTGGGGGAGGCTGG - Intronic
955194025 3:56788194-56788216 CTTGAGGACTGGGGGGTGGCGGG + Intronic
956558091 3:70543396-70543418 CTTGACGGGCTGAGAGTGGCAGG - Intergenic
960619015 3:119621466-119621488 CATGATGGCCTGAGAGTGGCTGG - Intronic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
961194596 3:124991055-124991077 CTTGTGGACTTTAGGGTGGCTGG - Intronic
961430889 3:126882158-126882180 CTTGGGGCTCTGAGGGTATCTGG - Intronic
962650021 3:137479177-137479199 CTTGAGGGCCTGAGGTGGGAGGG - Intergenic
962755897 3:138465220-138465242 CTTGAGGCACTGAGGGGGTCAGG + Intronic
963906778 3:150779451-150779473 CTGGAGGGGCCGAGGGTGGCTGG + Intergenic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
968250899 3:197212326-197212348 CTGGAGGCCCTAATTGTGGCTGG + Intronic
968516961 4:1019466-1019488 CGGGAGGCCCTGTGGGTGGTGGG + Intronic
968612565 4:1563859-1563881 GGTGCAGCCCTGAGGGTGGCCGG - Intergenic
968764146 4:2459381-2459403 GTTGAGTCACGGAGGGTGGCGGG - Intronic
969866134 4:10078149-10078171 CATGAGGCCCTCAAGCTGGCTGG + Intronic
971187127 4:24389634-24389656 GTTCTGGCCCTGAGGGAGGCTGG + Intergenic
971884269 4:32423480-32423502 CTTGAGGCCCCAAGGTTGGTGGG + Intergenic
975567262 4:75771379-75771401 CATGAGCCACTGAGCGTGGCTGG + Intronic
982203252 4:152978034-152978056 CTTGAGGGCCTCATGGTTGCAGG + Exonic
984778556 4:183504782-183504804 CGTGAGGCACGGAGGGTGACTGG + Intergenic
985573849 5:664703-664725 CCAGGAGCCCTGAGGGTGGCAGG - Exonic
985662169 5:1162674-1162696 TTCGAGGCCCTGGGGGTGGGGGG + Intergenic
985774160 5:1831952-1831974 CTTGAGGCCCGCAGGGGTGCTGG + Intergenic
986155931 5:5175923-5175945 CTTGAGGCTCTGAGGAGGGTAGG - Intronic
992488518 5:77218506-77218528 CCTGAAGCCCTAAGTGTGGCTGG + Intronic
997135314 5:131319220-131319242 AGTGAGGCACTGAGGGTGGGGGG - Intronic
997509812 5:134446457-134446479 CTTGCGGCATGGAGGGTGGCTGG + Intergenic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
1001749626 5:174118685-174118707 CTAGAGGCCCTGCATGTGGCTGG - Intronic
1002333447 5:178461385-178461407 CTAGAGGCACTGGGGATGGCAGG - Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003157195 6:3606913-3606935 CTTCAGTTCCTGAGGTTGGCGGG + Intergenic
1004426623 6:15511204-15511226 CTCGGGTCCCTGAGGGTGACGGG + Intronic
1005598978 6:27407073-27407095 CTTCAGCCCCTGAGGGTTCCTGG - Intergenic
1006175791 6:32120762-32120784 CTTCAGTACCTGGGGGTGGCTGG + Exonic
1006420561 6:33931281-33931303 CTTGAGGGCTGGAGGGTAGCGGG + Intergenic
1006469836 6:34222435-34222457 CTTGAGGCCAGGAGTTTGGCAGG + Intergenic
1006581107 6:35078490-35078512 CTGGTGGCCCTGAGGGGGTCAGG - Intronic
1007654941 6:43446207-43446229 GTTGAGGCCCTGAGGCTGGGTGG + Intronic
1008590592 6:52989950-52989972 CTTGGGAGGCTGAGGGTGGCAGG - Intronic
1011585812 6:88924021-88924043 CTGGAGGCCCTGAGGAGGGGTGG + Intronic
1013173078 6:107654895-107654917 ATTGAGGCTCTGAGGGAGGGTGG + Intronic
1015166790 6:130207802-130207824 CTTGAGGCACTGAGGCTGTGGGG + Intronic
1015994808 6:138987428-138987450 CTTGGGGCCCGGCGGGGGGCTGG - Intronic
1018178044 6:161196016-161196038 CTAGAGCCCCTGAAGGTGCCAGG + Intronic
1018799677 6:167212307-167212329 CTTGGGACCCAGAAGGTGGCTGG + Intergenic
1018831409 6:167446446-167446468 CCTGAAGCCCTGACGGGGGCAGG + Intergenic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019277620 7:184173-184195 CTCGAGGACGTGAGGGAGGCCGG - Intergenic
1019421410 7:952961-952983 TGGGAGGCCCAGAGGGTGGCTGG + Intronic
1019485641 7:1288091-1288113 CCTGGGCCCCTGAGGGTGGCAGG - Intergenic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1021792402 7:24218601-24218623 CTGGAGGCTATGATGGTGGCTGG + Intergenic
1023772243 7:43568399-43568421 CTGGAGGCTCTTAAGGTGGCAGG - Intergenic
1023794716 7:43782291-43782313 GTTGTGGCCCAGAGGCTGGCTGG + Intronic
1023869857 7:44257339-44257361 TTGGAGGCCCTGAGGCAGGCTGG - Intronic
1025120177 7:56295184-56295206 CTTCAGGCTCTCCGGGTGGCTGG + Intergenic
1026874326 7:73870913-73870935 ATGGAGGCCCTCTGGGTGGCAGG + Intergenic
1026911255 7:74093159-74093181 CCTGAGCCCCTGAGGGAGGATGG + Intronic
1029696538 7:102217413-102217435 GATGAGGCCCTGTGGTTGGCGGG - Intronic
1032480092 7:132239265-132239287 CTTGCAGCCCTGGGGGTGGGAGG + Intronic
1035228202 7:157445084-157445106 CCTGAGACCCTAAGGGTGGAGGG + Intergenic
1035397880 7:158546930-158546952 CCTGGGGCCCTGAAGATGGCTGG - Intronic
1035462343 7:159049754-159049776 ATTCAGGGCCTGAGGGTGGCAGG + Intronic
1035534173 8:378538-378560 CTTGAGGCCCTGGAGGAAGCGGG - Intergenic
1035664830 8:1373271-1373293 CGTGCGGCCCGGAGGGTGTCGGG + Intergenic
1038831706 8:31069256-31069278 GTTGAGCCTCTGTGGGTGGCAGG + Intronic
1039099431 8:33925019-33925041 CTTGAGGCCAGGAGTGAGGCAGG - Intergenic
1041447531 8:57969258-57969280 CTCGGAGCCCTGTGGGTGGCGGG + Intergenic
1043511068 8:80950647-80950669 CTGGAGGCCAGGAGGGCGGCAGG + Intergenic
1044792993 8:95866771-95866793 CTTGAGTTTCTGAGGGTGGTGGG + Intergenic
1047361307 8:124171985-124172007 ATTGAGGCCCTGAGTTTGGGCGG + Intergenic
1047647488 8:126884028-126884050 CTTGAGGGTCAGAGGATGGCAGG + Intergenic
1047717975 8:127613412-127613434 CTTGAGGCTATGAAGGTGGGAGG - Intergenic
1048329143 8:133460494-133460516 CTAGTGGCCCTGAGGGCGCCTGG - Intronic
1049064504 8:140302220-140302242 CGTGAGTCACTGAGGGTGGTGGG - Intronic
1049220065 8:141425034-141425056 CTTCAGGTCCTGGGGGTGGGAGG - Exonic
1049308602 8:141921204-141921226 CTCGGTGCCCTGATGGTGGCTGG - Intergenic
1049773448 8:144394188-144394210 GCTGAGGCTCTGGGGGTGGCCGG - Intronic
1049774357 8:144397690-144397712 CTTGGGTCCCTGGGGCTGGCAGG - Intronic
1053287518 9:36859475-36859497 ACTGAGACCCTGAGGCTGGCAGG - Intronic
1053391549 9:37739957-37739979 ACTGAGGGCCAGAGGGTGGCTGG - Intronic
1053444145 9:38138509-38138531 CTTGAGGACCTGGGGGAGGAGGG + Intergenic
1055864910 9:80801300-80801322 CATGAGGTCCTAAGGGTGGTGGG + Intergenic
1056840246 9:89992920-89992942 CTTGGGGCCCTGAGTGAGGGAGG - Intergenic
1057382756 9:94583821-94583843 CTTGAGGCCTTGAGGCTAGGTGG - Intronic
1060055135 9:120406753-120406775 CCAGAGGCACTGAGGGTGTCTGG + Intronic
1060399278 9:123338744-123338766 GTTGAGGCCCTGAGAGAAGCAGG + Intergenic
1060799233 9:126533138-126533160 CCTGAGGCCAGGATGGTGGCTGG - Intergenic
1060974054 9:127754587-127754609 CTAGAGGGCGGGAGGGTGGCGGG + Intronic
1060982893 9:127803667-127803689 CTTGAGGTCCTGAGGGTGGGAGG + Intronic
1061278107 9:129581173-129581195 CTTGAGGCCTTGAGGCTGGGAGG + Intergenic
1061498774 9:130990531-130990553 CATGGGGCCCTGAGGGGGACAGG - Intergenic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1062013327 9:134278414-134278436 CTTGTGGGCCTGTGGGTGGGCGG - Intergenic
1062357364 9:136171142-136171164 GCTAAGGCCCTGAGGCTGGCAGG - Intergenic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1189642878 X:43092934-43092956 CTTGGGGGGCTGAGGGTGGGAGG - Intergenic
1189861901 X:45281149-45281171 CATGAGTCCTTGAGGGTGGAGGG - Intergenic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1192089014 X:68132960-68132982 CCTGAGGCCCGGAGTGGGGCTGG - Intronic
1192269703 X:69567139-69567161 ATTGAAGCCATGAGGGTGGACGG + Intergenic
1192415746 X:70979101-70979123 CTCTAGGCCCTGAGGTTGGTTGG - Intergenic
1192639340 X:72847520-72847542 GCTGAGGCCCTGAGAGTGGCAGG + Intronic
1192642371 X:72873285-72873307 GCTGAGGCCCTGAGAGTGGCAGG - Intronic
1199708683 X:150452472-150452494 CTTGAGGGCCTGAGGGTGGAGGG + Intronic
1199743513 X:150757458-150757480 CCTGAGGTCGTAAGGGTGGCAGG - Intronic
1199875861 X:151927469-151927491 CTTGAGGTAGGGAGGGTGGCAGG + Intergenic
1199977700 X:152904126-152904148 CTGGAGGCCAACAGGGTGGCAGG - Intergenic