ID: 1020106375

View in Genome Browser
Species Human (GRCh38)
Location 7:5424008-5424030
Sequence ATAGGAATGGCTGTGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 9, 3: 27, 4: 229}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106375_1020106386 17 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106375_1020106379 -9 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106379 7:5424022-5424044 CATTCCTATAAAACCAATTACGG No data
1020106375_1020106389 30 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106389 7:5424061-5424083 AGTTTCCAGGCTCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 144
1020106375_1020106382 -1 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106382 7:5424030-5424052 TAAAACCAATTACGGACCTAGGG 0: 1
1: 0
2: 1
3: 1
4: 46
1020106375_1020106383 0 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106383 7:5424031-5424053 AAAACCAATTACGGACCTAGGGG 0: 1
1: 0
2: 0
3: 0
4: 54
1020106375_1020106381 -2 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106381 7:5424029-5424051 ATAAAACCAATTACGGACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 73
1020106375_1020106388 27 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106388 7:5424058-5424080 AGCAGTTTCCAGGCTCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106375 Original CRISPR ATAGGAATGGCTGTGGGCCA AGG (reversed) Intronic
900776681 1:4590943-4590965 ATAGGCCTGGCATTGGGCCAGGG + Intergenic
902471561 1:16650025-16650047 CTAGTCATGGCTGTGGCCCAGGG + Intergenic
903406811 1:23104138-23104160 ATCGGAATGGCTGTGGGTTGTGG - Intronic
903534092 1:24055163-24055185 ATAGGAAAGCCTGTTGGCCTTGG - Intergenic
903786370 1:25863832-25863854 ATGGCCATGGCTGTGGGCCTGGG + Exonic
905537180 1:38731489-38731511 TTAGGAATGGCTGTAGGAAAGGG - Intergenic
906137137 1:43507487-43507509 CTAGGAATGCATGTGGGGCAAGG - Intergenic
906736037 1:48129385-48129407 AGAGGAATGGCTGAGGGAAAAGG - Intergenic
908602529 1:65756441-65756463 CTAGAATTGGGTGTGGGCCAAGG + Intergenic
910624446 1:89291753-89291775 ATAAGAGTGGCTTTGGGCCTGGG - Intergenic
912595384 1:110870890-110870912 GGAGGAATGCCTGTGGGCAATGG + Intergenic
912823847 1:112887860-112887882 ACTGGCATGGCTGTGGTCCAGGG - Intergenic
914250576 1:145918599-145918621 ATAGGAATGGGGGTGGGGCGGGG - Intronic
914723158 1:150305988-150306010 ATTGGACTGGGTGTGGCCCAGGG + Intronic
915069153 1:153251676-153251698 GTAAGAATGGGAGTGGGCCACGG + Intergenic
916352331 1:163864964-163864986 ATTGGAAGGTCTGTGAGCCATGG - Intergenic
917719457 1:177773041-177773063 CTAGGATTGGCTGTAGGCCATGG - Intergenic
921213852 1:212921150-212921172 GTAGGAATGGATGGGGCCCACGG - Intergenic
923475161 1:234325110-234325132 CTAGGAAGGGGTGTGAGCCAAGG + Intergenic
923508463 1:234627577-234627599 ATAGGGATGGCAGTGGGCATGGG - Intergenic
1065810884 10:29442608-29442630 ATATGAGTGGCTGTGGCCCAGGG + Intergenic
1067108846 10:43384351-43384373 ATGGGCATGGCTGGGTGCCATGG + Intergenic
1071188893 10:83077899-83077921 ATATGAATGATTGGGGGCCATGG - Intergenic
1071485745 10:86101394-86101416 TAAGGAATTGCTGTGGGCAATGG - Intronic
1073210982 10:101802384-101802406 GTAGGAATGGCTGGGCGCGATGG + Intronic
1074315142 10:112354528-112354550 GTAGTTATGACTGTGGGCCATGG - Intergenic
1076007654 10:126960558-126960580 AGAGGTAGGGCTGTGGACCAAGG + Intronic
1077552394 11:3206458-3206480 GTAGGGCTGGCTGTGGGCCGAGG + Intergenic
1080574397 11:33584923-33584945 ATTGGAATGCATGTCGGCCATGG + Intronic
1083551055 11:63590496-63590518 AGACGCATGGCTGTGGGCCTTGG + Intronic
1084347105 11:68560353-68560375 ATAGGAATGACTGTGTGCTATGG + Intronic
1089304285 11:117516999-117517021 AGGGGAATGGCTCTTGGCCAAGG - Intronic
1089531814 11:119134810-119134832 ATGGGAATGGATGTGAGCTAAGG - Exonic
1090240097 11:125175696-125175718 ACAGGTATGGGTGTGGGCCTTGG + Intronic
1090245467 11:125213073-125213095 AGAGGAGTGCCTGTGGCCCAAGG - Intronic
1090298937 11:125616963-125616985 ATAGGAATGGCTGGGTGTGATGG - Intronic
1090377397 11:126300937-126300959 ATAGGAATGACCGTGGGGCATGG - Intronic
1091838812 12:3604763-3604785 ATAGCAAGGGCAATGGGCCAGGG + Intergenic
1092959282 12:13580573-13580595 ATGTGAATGGCTTTGGGCCTGGG + Intronic
1093133507 12:15420461-15420483 ATTGGAATGGCTGTGTTTCAGGG - Intronic
1093143369 12:15536263-15536285 ATAGGAAGTGCTGTGGGGGATGG + Intronic
1093373162 12:18388674-18388696 ATGGGTATGGTTGTGGGGCATGG + Intronic
1096807508 12:54149420-54149442 CTAGGATAGACTGTGGGCCACGG + Intergenic
1096964528 12:55615225-55615247 GTAGGAATGGCTTTGGGGCTAGG - Intergenic
1101285934 12:103312407-103312429 ATAGCATTTTCTGTGGGCCAAGG - Intronic
1102618763 12:114177013-114177035 ATAGGAATGGGGGTGGGGGAAGG + Intergenic
1102757785 12:115357373-115357395 ATAAGAATGGATGTGTGCCATGG + Intergenic
1103039087 12:117679876-117679898 GTAGGCATGACTGTGGTCCAAGG - Intronic
1103159688 12:118718594-118718616 AAAGGAAGGGCTCTGGGCCCAGG + Intergenic
1105016003 12:132787334-132787356 ATAGGAAAGCCTGTGGACCCAGG + Intronic
1105539825 13:21306810-21306832 GCATCAATGGCTGTGGGCCACGG + Intergenic
1105798498 13:23881240-23881262 GCATCAATGGCTGTGGGCCACGG - Intronic
1106832586 13:33601460-33601482 ATAGGAAAGGGTGGGAGCCAGGG + Intergenic
1111387020 13:87540313-87540335 ATCAGAATGGGAGTGGGCCAAGG + Intergenic
1112493123 13:99884735-99884757 ATAGGCACAGGTGTGGGCCAGGG + Intronic
1113017286 13:105841477-105841499 ATGAGAATGGGTGTGGGCCACGG + Intergenic
1115532940 14:34343670-34343692 ATATGAGTGACTGTGGCCCAGGG - Intronic
1115906017 14:38203895-38203917 ATAGGAAAATCAGTGGGCCAGGG + Intergenic
1117490517 14:56242074-56242096 GAAGGAATGGCTGTGTGCGAGGG + Intronic
1118269005 14:64323977-64323999 ATAGGACTGGCTGGGGGCAGTGG - Intronic
1118466125 14:66032840-66032862 AGTGGAATAGCTGTGGGCCAGGG - Intergenic
1119376240 14:74195939-74195961 AGAGAAATTGCTGTGGGTCAGGG - Intronic
1120623054 14:86789955-86789977 ATAGGAGTGACTATGGCCCATGG + Intergenic
1120958585 14:90104488-90104510 ATAGGAATGTATGTGTGACAGGG - Intronic
1121867764 14:97378751-97378773 TTAGGAATGGTTGAGGACCATGG + Intergenic
1122141263 14:99664322-99664344 TTAGGAATGGCTGTGGGGGCTGG - Intronic
1122454374 14:101838690-101838712 AAAGGATAGGCTGTGTGCCAGGG - Intronic
1122656197 14:103261007-103261029 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
1124937010 15:34183062-34183084 AAAAGAATGGATGTGGGCCAAGG - Intronic
1125273594 15:37967864-37967886 AAAGCAATGGCAGTGGACCAAGG - Intergenic
1125888616 15:43249034-43249056 GTAGGAAAGGGTGTGGGCGATGG - Intronic
1127288981 15:57553878-57553900 ATGGGAAAGGCTGGGGGCCCAGG - Intergenic
1128666634 15:69542976-69542998 ATAGGAATGGGAGAGGGCAATGG - Intergenic
1128786066 15:70398500-70398522 ATAGGCATGGCTGTTCGACATGG - Intergenic
1129119687 15:73388475-73388497 GTAGGCATGGGGGTGGGCCAGGG - Intergenic
1129246454 15:74281846-74281868 TGAGGTAAGGCTGTGGGCCAGGG + Exonic
1130438475 15:83926307-83926329 ATAGGAATGGGCAAGGGCCACGG + Intronic
1131336301 15:91552697-91552719 GTAGGAATGTCTGGGGACCAAGG - Intergenic
1133423453 16:5666631-5666653 ATAGGACTGGCAGTGAGCTAGGG + Intergenic
1136095924 16:27956560-27956582 ATGGGACTGGCTGTGGCCAATGG + Intronic
1136924931 16:34363067-34363089 ATAGGAAAGGCTGTGGTCACAGG - Intergenic
1136979642 16:35048739-35048761 ATAGGAAAGGCTGTGGTCACAGG + Intergenic
1137391428 16:48084587-48084609 CCAGGAGGGGCTGTGGGCCAAGG - Intronic
1139378027 16:66512977-66512999 ATGGGATTGGCTGTGAGGCAGGG - Intronic
1139784245 16:69378426-69378448 ATAGTATTGCCTGGGGGCCAGGG + Intronic
1143514577 17:7413419-7413441 AGAGGAGGGCCTGTGGGCCAGGG + Intronic
1144249957 17:13406259-13406281 AGAGGACTGCCTGTGGGCCATGG - Intergenic
1144734141 17:17545477-17545499 ATAGGAATGGCCCTGGGGCTGGG - Intronic
1148502632 17:48103342-48103364 ACAGGAATGGGTGGGGGGCAGGG - Intronic
1149467386 17:56890836-56890858 ATAGCCTTGGCTGTGGGGCAAGG - Exonic
1150363141 17:64555940-64555962 ATGGGAATGGCTGTGTTTCATGG - Exonic
1203162949 17_GL000205v2_random:68514-68536 ATAGGCCTGGCCATGGGCCAGGG - Intergenic
1153817489 18:8803302-8803324 CTTGGAGTGGCTGAGGGCCAAGG - Intronic
1155909664 18:31493679-31493701 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
1156320250 18:36014449-36014471 ATAGGCAAGGCTGGGCGCCATGG + Intronic
1159027633 18:63200577-63200599 ATAGAGTTGGCAGTGGGCCATGG + Intronic
1159916028 18:74188559-74188581 AGAGAAAGGGCTTTGGGCCAAGG - Intergenic
1161007264 19:1942772-1942794 AGAGGAAAGACTGTGTGCCAGGG + Intronic
1162240880 19:9353344-9353366 TTAAGAATTGCTGTGGGTCAGGG + Intronic
1163471165 19:17497706-17497728 ATAGGTATGGCTGTGCGCCCTGG + Intronic
1163871412 19:19824416-19824438 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
1163885325 19:19960155-19960177 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
1163889050 19:19994687-19994709 ATAGGCCTGGCATTGGGCCAGGG + Intergenic
1163896871 19:20067050-20067072 ATAGGCCTGGCTTTGGGCCAGGG - Intergenic
1163907775 19:20162078-20162100 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
1163934814 19:20433275-20433297 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
1163938345 19:20470905-20470927 ATAGGCCTGGCATTGGGCCAGGG + Intergenic
1164455865 19:28406048-28406070 AAAGACCTGGCTGTGGGCCAGGG - Intergenic
1164980097 19:32607413-32607435 ATGGGAGTGGCAGTGGGGCAGGG + Intronic
1165854251 19:38870336-38870358 GCAGGGGTGGCTGTGGGCCAGGG - Intronic
1166514465 19:43436004-43436026 AAAGAAATGGCTGGGTGCCATGG + Intergenic
1167945977 19:52989327-52989349 CTAGGAATGGCTGTTGGGAATGG + Intergenic
925367124 2:3318131-3318153 GTCGAAACGGCTGTGGGCCAAGG + Intronic
925778526 2:7357749-7357771 GAAGGAATGGCTGAGGGCTAAGG - Intergenic
926389874 2:12378592-12378614 AAAAGAATGCCTGGGGGCCATGG + Intergenic
928284169 2:29974472-29974494 ATAGGACTGGTTGTTGGCCAGGG - Intergenic
930020251 2:46997540-46997562 ACAGGTATGGCTGTTGGTCAAGG + Intronic
931129738 2:59321896-59321918 ATTGGAATCACTGTGGGGCAGGG - Intergenic
931857812 2:66322263-66322285 AGAGGAATGGCAGTTTGCCATGG + Intergenic
932221007 2:69998980-69999002 ACAGGACTGTCTCTGGGCCAGGG + Intergenic
932676164 2:73783381-73783403 GTAGGAAAGGATGTGGTCCAAGG - Intergenic
932886393 2:75553061-75553083 ATAGGCATGGCTGGGGACAAAGG - Intronic
933346885 2:81098116-81098138 AAAGGAATGGCTGGGCGCGATGG - Intergenic
933734141 2:85481454-85481476 GTAGGAATGGTCGTGAGCCATGG - Intergenic
934764148 2:96870824-96870846 CTAGGAGTGGCTGTGGGCGGAGG - Intergenic
936664376 2:114577349-114577371 ACAGGAAGGCCTGTTGGCCAAGG - Intronic
936836630 2:116718142-116718164 ATAGGCCTGGCATTGGGCCAGGG - Intergenic
937094329 2:119225580-119225602 AAGGGAAGGGCTGTGGGCCAAGG - Intronic
938131564 2:128720036-128720058 ATAGGAATGGCCGGGGTCCCTGG + Intergenic
939386895 2:141512318-141512340 ATGTGAATGGCTGTGTGCCCTGG - Intronic
939989669 2:148865457-148865479 ATAGGAATGGCGCTGGGCCCGGG + Intergenic
940044858 2:149398969-149398991 AAAGGGATGGCTGGGGACCAAGG + Intronic
943360243 2:186910758-186910780 ATAGAAATCTCTGTGTGCCAGGG + Intergenic
943736346 2:191359810-191359832 ATACAAAAGGCTGTGGGCAAAGG - Intronic
945903966 2:215569939-215569961 ATAGGAATGGCATTAGGCAAAGG + Intergenic
946864606 2:224031597-224031619 ATACCAATGGCTGTGGGCAGAGG - Intronic
948908422 2:240991090-240991112 ACAGGAAGGGCTGGAGGCCATGG - Intronic
1172629641 20:36369300-36369322 ATAGTAATGGCTGCCGGGCATGG + Intronic
1173176774 20:40770895-40770917 AAGGGAAGGGCTGTGGTCCATGG - Intergenic
1174526735 20:51177982-51178004 ATAGAAAAGGCTTTGAGCCAGGG + Intergenic
1174913273 20:54629799-54629821 TTAGGAATGGCTGTCTGCCTGGG - Intronic
1179050195 21:37882514-37882536 AGAGGAAAGGCTGGGGGCGAAGG - Intronic
1179614818 21:42575634-42575656 AGAGGCATGGCTGTGGGTCTGGG - Intronic
1179874816 21:44262282-44262304 ATAGGGGTGGCTGTGGGGTAGGG + Intergenic
1181307969 22:21927627-21927649 CCAGGGATGGCTGTGGGACAGGG + Intronic
1182447854 22:30399980-30400002 ATGGAAAAGGCTGTGGGCCAAGG - Intronic
1183354701 22:37351848-37351870 CTGGGAATGGCTCTGGGCCAGGG + Intergenic
1184293471 22:43509949-43509971 TGAGGAATGGATGTGGGGCATGG + Intergenic
1185213531 22:49585779-49585801 AGAGGAAGGGCTGTGGGACTCGG + Intronic
949282522 3:2362613-2362635 ATAGCAAGGGCTGAGGGCCTAGG + Intronic
949819009 3:8094697-8094719 AGAGGAAAGGCTGTGTGCAAAGG + Intergenic
950425596 3:12923299-12923321 ATAGGAATGGCTGCAGGGGATGG + Intronic
950548326 3:13652182-13652204 CTAGGAAGGGCTGGTGGCCAGGG - Intergenic
952907304 3:38149763-38149785 GTAGGAATGACTGGGGGCCCTGG + Intergenic
953391825 3:42538374-42538396 ATAGAAGTGACTGTGAGCCATGG + Intergenic
953732155 3:45458987-45459009 CTAGGAAGGGCTGGGAGCCATGG + Intronic
954675942 3:52315481-52315503 AAAGGCATGGCCCTGGGCCAGGG + Intergenic
955950228 3:64236347-64236369 ATAGGATAGGCTGTGGGTCATGG - Intronic
959482974 3:106895893-106895915 ATAGTATTGGCTGGGCGCCATGG + Intergenic
963383682 3:144563403-144563425 ATAGCATCTGCTGTGGGCCAGGG + Intergenic
963778407 3:149463364-149463386 ATAGGAATTGGTGTGGGGCGGGG - Intergenic
964207896 3:154195187-154195209 ACAGGAGTGGCTGTGAGCCCAGG + Intronic
964432082 3:156617826-156617848 ACAGGAATTGTTGGGGGCCATGG + Intergenic
964883038 3:161445688-161445710 ACTGGAATGGCTGTGGGTGATGG + Intergenic
965339276 3:167466205-167466227 ATAGGCATGACTGGGTGCCATGG + Intronic
966164251 3:176999308-176999330 AGAGAAGTGGCAGTGGGCCAGGG + Intergenic
967371256 3:188748966-188748988 AAAGGAATGGCAGTAGGACATGG - Intronic
967971848 3:195005101-195005123 ACACGAATGGCTGTGGGGCCTGG - Intergenic
971002540 4:22338992-22339014 ATAGGCCTGGCATTGGGCCAGGG + Intergenic
972844294 4:42969692-42969714 ATTGTAATGCCTGTGTGCCAGGG - Intronic
974009891 4:56597059-56597081 AAATGAATGACTGTGGGGCAGGG + Intronic
978528685 4:109692778-109692800 ATTGGAATGTCTGTGGGACATGG - Intronic
978685850 4:111442284-111442306 ATAGGAAGGGGTGGGGGCAATGG - Intergenic
980448593 4:132943095-132943117 ATAGAAATGGCTGGGTGCCTAGG - Intergenic
981092413 4:140745229-140745251 ATATGAGTGACTGTGGTCCAAGG - Intronic
981427333 4:144618496-144618518 ATATGAGTGACTGTGGCCCAGGG - Intergenic
982213051 4:153056484-153056506 ATAGGAGTGGGGGTGGGACAAGG + Intergenic
984188288 4:176573220-176573242 ATGGGAATGGCTGTAGTCCAAGG + Intergenic
984504797 4:180603469-180603491 ATAGGAATTACTATGGGCAATGG + Intergenic
986403895 5:7406458-7406480 CTTGGAATTGCTGTGAGCCAAGG - Intronic
986619241 5:9653633-9653655 ATTGGAATGGCTGTGCACTATGG - Intronic
994662135 5:102666851-102666873 ATAGGTATGGCTGTGTGGTAAGG - Intergenic
995433081 5:112104437-112104459 ATAGCAATGGCTGTTGGCAAAGG - Intergenic
997200704 5:132008494-132008516 ATAAGAATAGATGTGGTCCAAGG - Intronic
999425511 5:151484845-151484867 ATAGGAATGGGTGTAGGCTCTGG - Intronic
999656596 5:153816667-153816689 GTAAGAATGTCTATGGGCCAAGG + Intergenic
1000098281 5:157990154-157990176 AAAGGAAGGGCTGGGTGCCATGG + Intergenic
1000883583 5:166724519-166724541 ATGGGTATGGCTGTGTTCCAGGG - Intergenic
1001722662 5:173869366-173869388 TCAGGAATGCCTGGGGGCCATGG - Intergenic
1001850055 5:174955896-174955918 CTAGAAAAGGCTGTGGGCCAAGG - Intergenic
1001941500 5:175742833-175742855 AAACCAATGGCTGTGGGGCATGG - Intergenic
1002292520 5:178209579-178209601 ATAGGAACGGCTCTGGGTCAGGG + Intronic
1002306172 5:178285172-178285194 ATAGGAGTGGCTGGAGGACACGG - Intronic
1003551047 6:7102190-7102212 AAAGTAATGGATTTGGGCCATGG - Intergenic
1004379006 6:15116080-15116102 AGAGGAATGGCTGTGAGGCAAGG + Intergenic
1004423504 6:15492107-15492129 TGACGGATGGCTGTGGGCCAAGG + Intronic
1004859836 6:19792213-19792235 GTAGGAGTGGATGTGGGACATGG + Intergenic
1005522325 6:26612091-26612113 ATAGGAAGGCCAGTGGGCCTGGG + Intergenic
1006463430 6:34177215-34177237 CTGGGCATGGCCGTGGGCCAGGG - Intergenic
1006833457 6:36982902-36982924 AGAGGAATCGCTCTGGTCCATGG - Intronic
1007081191 6:39105718-39105740 AGAGGAATGGCTGTGTTCCATGG + Exonic
1007125219 6:39420471-39420493 ATAGGAGTGGCGGTGTTCCAGGG - Intronic
1007198579 6:40085441-40085463 ATAGGTAGGGCTTTTGGCCAGGG - Intergenic
1007734725 6:43973393-43973415 ATAAAAATAGCTGTGGGCAAGGG + Intergenic
1007969889 6:46040710-46040732 ATAGTAGTGGCTGTGGTGCAGGG + Intronic
1016534078 6:145091305-145091327 ATAAGAGTGGCAGTGGGCTAGGG + Intergenic
1019062528 6:169266447-169266469 ACAGGCCTGGCTGGGGGCCAGGG + Intergenic
1020106375 7:5424008-5424030 ATAGGAATGGCTGTGGGCCAAGG - Intronic
1021838136 7:24700919-24700941 CTAGAAATGCCTGTGGGCAAAGG - Intronic
1022104172 7:27186337-27186359 AAAGGACGGGCTGAGGGCCAAGG + Intergenic
1024019907 7:45359334-45359356 AAATGAATGGCTGTGGGTGATGG + Intergenic
1024192857 7:47030603-47030625 AGAGGAATGGCTGTATGACAGGG + Intergenic
1024446620 7:49487395-49487417 ATAGGAGTCACTGTGGCCCAGGG + Intergenic
1024575535 7:50760822-50760844 TCAGGAATGGCTGTGAGCCCTGG - Intronic
1024976359 7:55117468-55117490 AGAGGAACGGCTCTTGGCCATGG + Intronic
1026929853 7:74217766-74217788 AAGAGAATGGCTGTGGGCCCAGG + Intronic
1027433984 7:78144814-78144836 ATAGGTATGCGTGTGTGCCATGG + Intronic
1027656457 7:80936193-80936215 ATAGGAAAATCTGTGGCCCAGGG - Intergenic
1028618458 7:92797593-92797615 AAAGGTATGTCTGAGGGCCAGGG - Intronic
1031630054 7:124033732-124033754 AGACGAATGGCTGAGTGCCACGG + Intergenic
1032444690 7:131972195-131972217 ATTGGAATGGTTGTGAGCTAGGG + Intergenic
1032479639 7:132235995-132236017 ATGGGCAAGCCTGTGGGCCAGGG + Intronic
1034281276 7:149856100-149856122 AAGAGAATGGCTGAGGGCCAGGG - Intronic
1035230393 7:157462363-157462385 ATAGGCATGACAGTGGGACACGG + Intergenic
1037410412 8:18589806-18589828 AAAGCAAAGGCTGTGGGCAAGGG + Intronic
1039662723 8:39484472-39484494 AGAGGAAGAGCTTTGGGCCAGGG - Intergenic
1043494921 8:80790400-80790422 TTAGGAATGCCTGAGGGCCAAGG + Intronic
1043849520 8:85199957-85199979 ATGGGACTGGCTGGGTGCCATGG + Intronic
1043859128 8:85295591-85295613 AGAGGAATGGAAGTGGGCAAGGG - Intergenic
1044316386 8:90753619-90753641 ACAGGAGTGCCTGTGGACCATGG + Intronic
1045680587 8:104655476-104655498 ATATGAGTGACTGTGGCCCAGGG - Intronic
1047153345 8:122289571-122289593 ATAGGACTTGCTTTGGGCAATGG + Intergenic
1047227641 8:122970290-122970312 AGAGGAGTGGCTGTGACCCAAGG - Intronic
1049021409 8:139959940-139959962 AGAGCAAGGGCTGTGGGCGATGG + Intronic
1049227860 8:141466302-141466324 ATAGAAGTCCCTGTGGGCCATGG + Intergenic
1049324500 8:142014980-142015002 ATAGGCAGGGCTGGGGTCCAGGG + Intergenic
1049374294 8:142281694-142281716 AGAGGAAGGGCTGTGGCCCAGGG + Intronic
1049860524 8:144895146-144895168 ATAAGAATGGATGTGGGTGAGGG + Intronic
1050258920 9:3820793-3820815 ATAGGAAGGGCTGTGACCTAGGG + Intergenic
1050555635 9:6787526-6787548 AGAAGAATGGCTCTGGGCCTGGG - Intronic
1052181843 9:25538441-25538463 AGAGGAATGGTTGTGTGCCTTGG - Intergenic
1056089475 9:83190665-83190687 AAAGGCATGGCTGTTTGCCAAGG + Intergenic
1057002193 9:91520352-91520374 ATAGGTCTGTCTGTGGGCTAGGG + Intergenic
1057345180 9:94244034-94244056 ATAGGAATGTCTGTGGAGAAAGG + Intergenic
1059576147 9:115490853-115490875 ATAAGATTGGGAGTGGGCCAAGG - Intergenic
1060312237 9:122472472-122472494 ATAGGCAGGGCTTTTGGCCACGG - Intergenic
1062363284 9:136197516-136197538 AGAGGAGGGGCTGGGGGCCAGGG + Exonic
1187076977 X:15945156-15945178 AGAGAAATGGCTGTGAACCATGG + Intergenic
1190677904 X:52797743-52797765 ATAGGAATGGCTGTGGGGAAGGG - Exonic
1192067731 X:67904055-67904077 ATGGGAGTGGCTGGGGACCACGG + Intergenic
1192284917 X:69725308-69725330 AAAGGTATGGCTGTGGGCATGGG - Intronic
1196715792 X:118809891-118809913 ATAAGAATGGCTGTGTCCCTGGG + Intergenic
1196932684 X:120696737-120696759 TTAGTAATGGTTGTGGCCCAGGG - Intergenic
1197154768 X:123258439-123258461 ATAGGAAGGCATGTGGGCAAAGG - Intronic
1198854493 X:141002296-141002318 ATAGGAATGGCTGTGGGGAAGGG + Intergenic
1198877524 X:141242832-141242854 ATAGGAATGGCTGTGGGGAAGGG - Intergenic
1198908207 X:141585053-141585075 ATAGGAATGGCTGTGGGGAAGGG - Intronic
1198908584 X:141589371-141589393 ATAGGAATGGCTGTGGGGAAGGG + Intronic
1198918486 X:141698781-141698803 ATAGGAATGGCTGTGGGGAAGGG - Intergenic
1199033227 X:143025591-143025613 ATAGGAATGGCTGTGGGGAAGGG + Intergenic
1199075246 X:143517791-143517813 ATAGGAATGGCTGTGGGGAAGGG - Intergenic
1199094226 X:143721065-143721087 ATAGGAATGACTGTGGGGAAGGG - Exonic
1199214110 X:145247165-145247187 ATAGGAATGGCTGTGGGGAAGGG + Exonic
1200807304 Y:7445971-7445993 ATAGGACTGTCTGTGCACCAGGG - Intergenic
1201393398 Y:13522651-13522673 ATAAGAATGGGTGTTGGTCATGG - Intergenic
1201748062 Y:17402413-17402435 ATAGGCCTGGCATTGGGCCAGGG - Intergenic