ID: 1020106376

View in Genome Browser
Species Human (GRCh38)
Location 7:5424014-5424036
Sequence GGTTTTATAGGAATGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106376_1020106391 26 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106391 7:5424063-5424085 TTTCCAGGCTCCCCTCGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1020106376_1020106381 -8 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106381 7:5424029-5424051 ATAAAACCAATTACGGACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 73
1020106376_1020106389 24 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106389 7:5424061-5424083 AGTTTCCAGGCTCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 144
1020106376_1020106382 -7 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106382 7:5424030-5424052 TAAAACCAATTACGGACCTAGGG 0: 1
1: 0
2: 1
3: 1
4: 46
1020106376_1020106386 11 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106376_1020106390 25 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106390 7:5424062-5424084 GTTTCCAGGCTCCCCTCGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1020106376_1020106388 21 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106388 7:5424058-5424080 AGCAGTTTCCAGGCTCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 238
1020106376_1020106383 -6 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106383 7:5424031-5424053 AAAACCAATTACGGACCTAGGGG 0: 1
1: 0
2: 0
3: 0
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106376 Original CRISPR GGTTTTATAGGAATGGCTGT GGG (reversed) Intronic
902148657 1:14424773-14424795 CTTTTTATAGGAATGGCTTGAGG - Intergenic
902475565 1:16683142-16683164 TTTTATTTAGGAATGGCTGTTGG - Intergenic
905800137 1:40837944-40837966 GGGTTTATGGGAATGTCTGGCGG - Intronic
906665291 1:47617130-47617152 TGTTTTATAGGAATGGTGGTCGG + Intergenic
908751327 1:67426715-67426737 GGTTATTTATGAATGGCTGCTGG - Intronic
911855361 1:102869301-102869323 GGTTTCATGGGCAGGGCTGTTGG - Intergenic
912144410 1:106774399-106774421 TGCTTTATAGGAGTGGCTGAGGG + Intergenic
912791814 1:112659691-112659713 GTTTTAATAGGAATGGTCGTTGG + Exonic
916446640 1:164878654-164878676 GGTTTTAGGGGAATTGCTATAGG + Intronic
917184856 1:172341844-172341866 GGTTTTATTGCAATTGCTTTTGG - Intronic
917231120 1:172839178-172839200 TGTTCTCTATGAATGGCTGTGGG - Intergenic
918029764 1:180794699-180794721 GGTTGTTTGGGGATGGCTGTAGG + Intronic
921108925 1:212014160-212014182 GGTTTGATAAGAATAGCTGAAGG + Intronic
922814827 1:228441193-228441215 GGTTTCAAAGGAATGGCTCTGGG - Intergenic
922939023 1:229445078-229445100 GGTTTTATTTTGATGGCTGTGGG + Intronic
1069086475 10:64145553-64145575 GGATTTATTTGAAAGGCTGTTGG + Intergenic
1069925471 10:71847397-71847419 GATTTTATAGGCATGGTGGTGGG + Intronic
1071003389 10:80855927-80855949 AGTTTTCTAGCAATAGCTGTGGG + Intergenic
1074822203 10:117188818-117188840 GGTCATCTGGGAATGGCTGTAGG + Intergenic
1075550215 10:123387268-123387290 TGTTTTACATGAATGGCAGTAGG - Intergenic
1076211860 10:128654583-128654605 GGTTTTATTACAATGGATGTTGG - Intergenic
1078621496 11:12912839-12912861 AGTCTTTTAGGAATAGCTGTTGG - Intronic
1081634824 11:44714120-44714142 GGTGTTATAGGAATGGCCAGGGG + Intergenic
1083793201 11:64999220-64999242 GTTTAACTAGGAATGGCTGTGGG + Intergenic
1094816885 12:34196148-34196170 AGTTTAATAGGAATAGCTTTGGG - Intergenic
1095371534 12:41473429-41473451 GGTTTTATAGGAAAGGCTCTTGG - Intronic
1095787746 12:46128735-46128757 GGTGTTATAAGAATGGCATTAGG - Intergenic
1099216485 12:79859964-79859986 GATTTTATAGACATTGCTGTTGG - Intronic
1101411836 12:104475326-104475348 TGCTTTATAATAATGGCTGTGGG + Intronic
1102242586 12:111334434-111334456 GGTTCTGTGGGACTGGCTGTGGG - Exonic
1105911109 13:24868590-24868612 GGTGTTTTAGGAATTGCTTTCGG + Exonic
1106064005 13:26326371-26326393 GGTCTTATAGGTATCGTTGTTGG + Intronic
1106220336 13:27741541-27741563 GCATTTACAGGAAAGGCTGTCGG - Intergenic
1106907706 13:34425802-34425824 GGTTGTGTATGCATGGCTGTGGG + Intergenic
1108920982 13:55674066-55674088 GGTTTTATAGGCAAGACTGGAGG + Intergenic
1120006963 14:79369347-79369369 AGTTTTATAGGAAAGGCGATTGG + Intronic
1120571989 14:86130109-86130131 GGTTTTTTTGGTATGGCTGCTGG + Intergenic
1125235854 15:37512565-37512587 GTCTTTGTATGAATGGCTGTGGG + Intergenic
1126239273 15:46422841-46422863 GTTTCTATAAAAATGGCTGTTGG - Intergenic
1127680908 15:61297138-61297160 AGGCTTAAAGGAATGGCTGTGGG + Intergenic
1128487998 15:68115734-68115756 TGTTTATTAGGAATGGTTGTTGG + Intronic
1128668896 15:69559453-69559475 GGTTTTCTAGGGAAGGCTGGTGG + Intergenic
1128832471 15:70782008-70782030 TGTTTTATAGGAAGTGTTGTGGG - Intergenic
1140514557 16:75532622-75532644 GGTTTTCCAGGAGTGGGTGTGGG - Intronic
1141298891 16:82794915-82794937 GGACTTAAAGAAATGGCTGTGGG + Intronic
1143161769 17:4876547-4876569 GCTTTTATTGGCATGGATGTGGG + Intronic
1143931190 17:10427789-10427811 TGTTTTCCAGGAATGGATGTTGG + Intergenic
1144477623 17:15602343-15602365 GGTTATATAGTAGTTGCTGTGGG + Intronic
1144920615 17:18761031-18761053 GGTTATATAGTAGTTGCTGTGGG - Intronic
1146759305 17:35462375-35462397 GCTTTTATAGTAATTGCTGTAGG + Intergenic
1149245742 17:54705305-54705327 GGATTATTAGGAATGGATGTTGG - Intergenic
1150371121 17:64638952-64638974 GGTGGCATTGGAATGGCTGTGGG - Intronic
1153855813 18:9145327-9145349 GTTTTTAGAGGAATGTCTCTAGG + Intronic
1155816209 18:30314607-30314629 GGTTTTATAGGGTAGGCTGTAGG + Intergenic
1158296683 18:56004154-56004176 GATTTTATATGAATGACTTTTGG - Intergenic
925156666 2:1653421-1653443 GGTTTAATAGGAATCTCTGGGGG - Intronic
927112403 2:19873054-19873076 GGTTTTCTAGGGAAGGCAGTTGG + Intergenic
928587552 2:32776325-32776347 AGTTTTGTGGGAATGGCTGAAGG + Intronic
928794812 2:35005212-35005234 GGTGTTATAGGAATGCCTGTGGG - Intergenic
929444106 2:41989323-41989345 GGATTTATTGGAGTGGATGTTGG - Intergenic
930383556 2:50662417-50662439 GGTTTTGTAGGAATTGTTTTTGG - Intronic
932528394 2:72498831-72498853 GGACTTATAGGAAGGGATGTAGG - Intronic
933124760 2:78590791-78590813 AGTTTTAAAAGAATCGCTGTTGG + Intergenic
936976404 2:118225673-118225695 GGTTTTGTAGGTATGTGTGTTGG - Intergenic
938206872 2:129431635-129431657 GGGTTTCAAGGAATGGCAGTTGG + Intergenic
1170601288 20:17843393-17843415 GGGTTTGGAGGAAGGGCTGTGGG + Intergenic
1170825762 20:19793779-19793801 CGTTTTGTAGGAAAAGCTGTGGG + Intergenic
1171778812 20:29398622-29398644 AGTTTAATAGGAATAGCTTTGGG - Intergenic
1171820594 20:29833927-29833949 GGTTTAATAGGAATAGCTTTTGG - Intergenic
1178301131 21:31454007-31454029 GCATTTATAGGAAAGGCTTTGGG - Intronic
1180324625 22:11358876-11358898 AGTTTAATAGGAATAGCTTTAGG - Intergenic
1183047905 22:35235378-35235400 GGTTTTATTGCAATTGCTTTAGG + Intergenic
951103719 3:18719123-18719145 GGTTTTCTGGGAAAGCCTGTGGG - Intergenic
951387160 3:22056526-22056548 TGTTTAATTGGAATGGCTTTAGG - Intronic
953118523 3:40016265-40016287 GATATTTTAGTAATGGCTGTTGG + Intronic
953170984 3:40507022-40507044 GTTTTTATAGGAATGGATGTTGG + Intronic
953560611 3:43988653-43988675 TGTCTTATAGGAATTGCTGAAGG - Intergenic
954848240 3:53578304-53578326 GGTTTTATAGGCATAGCTGTTGG + Intronic
954860026 3:53680159-53680181 GTTTCCATAGAAATGGCTGTCGG + Intronic
956078468 3:65532030-65532052 GGATTTATAGGAATTGATGATGG - Intronic
957086329 3:75681932-75681954 AGTTTAATAGGAATAGCTTTGGG + Intergenic
957953194 3:87150355-87150377 GGTTTTATGGGCCAGGCTGTGGG - Intergenic
958498730 3:94878122-94878144 GATTTAAAAGAAATGGCTGTAGG - Intergenic
959361531 3:105399904-105399926 GTTTTTATACGAAGGGATGTAGG - Intronic
960013081 3:112854602-112854624 GGTTTTGTTGCAATTGCTGTTGG - Intergenic
964661825 3:159128490-159128512 ATTTTTCTAGGAATGTCTGTTGG + Intronic
965263831 3:166515868-166515890 GCTTTTATTGGAATTGCTTTTGG - Intergenic
971917505 4:32892602-32892624 GGTTTTATTCCAATAGCTGTTGG + Intergenic
975972301 4:80055016-80055038 TTTTTTATAGAAATGGCTGTAGG - Intronic
976047711 4:80971512-80971534 GTTTTTATTGCAATGGCTTTTGG - Intergenic
978063097 4:104363277-104363299 GGTTATCTAGGAATGGAAGTGGG + Intergenic
979116815 4:116834801-116834823 GCTTTTATTGGAATTGCTTTTGG - Intergenic
979781540 4:124657430-124657452 GTTTTTTTATGAATGGGTGTTGG - Intergenic
983985587 4:174056196-174056218 GGTTTTATTGCAATTGCTTTTGG + Intergenic
984937094 4:184898870-184898892 GGGGTGATAGGAGTGGCTGTGGG - Intergenic
989749222 5:44871309-44871331 GGTTTGTTGGGAATGGCTCTTGG + Intergenic
990336673 5:54779651-54779673 CGTTTTATTAGAATGGATGTTGG - Intergenic
993362330 5:86993132-86993154 GGTTTCATTGGAATTGCTTTTGG + Intergenic
993545005 5:89201052-89201074 CATTTTATAGGAAAGGCAGTTGG + Intergenic
994207112 5:97047587-97047609 GGTTTTATAGGAAGAGCTTCAGG - Intergenic
994558398 5:101333764-101333786 GGTTTTATTGCAATTGCTTTTGG - Intergenic
995433083 5:112104443-112104465 GTTTCCATAGCAATGGCTGTTGG - Intergenic
995684037 5:114751376-114751398 AGGTTGAAAGGAATGGCTGTTGG - Intergenic
996006389 5:118425891-118425913 GGTTTTTTTGGTATGTCTGTTGG - Intergenic
996201933 5:120686218-120686240 GTTTTTACAGGATTGGCAGTTGG - Exonic
997461453 5:134055234-134055256 TGTTTCTTAGGAATGGCAGTTGG + Intergenic
998532058 5:142894517-142894539 TGTTGTACAGGAATGGCTGCTGG - Intronic
999367435 5:151032289-151032311 GGTTCTGTAGGCCTGGCTGTGGG + Exonic
999425512 5:151484851-151484873 GGTGGTATAGGAATGGGTGTAGG - Intronic
1001236811 5:170036726-170036748 GGTTTTATGGGGCTGACTGTGGG - Intronic
1006233268 6:32603870-32603892 GTTTTTATAGCTATGTCTGTTGG - Intergenic
1007037584 6:38691169-38691191 GGTTTTACAGGGATGGCTACTGG + Intronic
1007267547 6:40608576-40608598 GGTGGTATAGGAATGTATGTAGG + Intergenic
1008021261 6:46580468-46580490 GTTTTTATTGCAATGGCTTTTGG - Intronic
1009026489 6:58006701-58006723 GGTTTGAAAACAATGGCTGTGGG + Intergenic
1009202039 6:60758174-60758196 GGTTTGAAAACAATGGCTGTGGG + Intergenic
1010322764 6:74532004-74532026 GGTTTTGTTGCAATTGCTGTTGG - Intergenic
1012250871 6:96979168-96979190 GGTTTTGTTGGAATTGCTTTTGG + Intronic
1012893021 6:104918575-104918597 AGTTTTGTAGTGATGGCTGTAGG + Intergenic
1013877949 6:114856897-114856919 GTTTTTATTGGATTTGCTGTTGG - Intergenic
1014616957 6:123614187-123614209 GGTTTGGGAGGCATGGCTGTAGG + Intronic
1015947372 6:138516477-138516499 GGGTTTGTGGCAATGGCTGTGGG + Intronic
1018894979 6:168008132-168008154 GGTTTTATGGGAATCTCTTTTGG - Intronic
1019507448 7:1399485-1399507 GGATTTATAAGAATGGCAGGAGG + Intergenic
1020106376 7:5424014-5424036 GGTTTTATAGGAATGGCTGTGGG - Intronic
1020415539 7:7941802-7941824 GGTTTGATAGAATTGGATGTTGG + Intronic
1024173807 7:46817644-46817666 AGTTTTATAGGAAGGGCTCATGG - Intergenic
1024713214 7:52041691-52041713 GGTTTTTTAGTGATGGCTCTAGG - Intergenic
1025641158 7:63370960-63370982 TGTTTTATTTGAATGGCTATGGG + Intergenic
1027395620 7:77750763-77750785 GGTTTTCTAGGAACGGTTTTTGG + Intronic
1028813799 7:95120732-95120754 AGTATTATTGGAATGGGTGTTGG + Exonic
1032205117 7:129856792-129856814 GGTTTCACAGGGATGACTGTGGG + Intronic
1032287898 7:130556812-130556834 TGTTTATTAGGAATGGATGTTGG - Intronic
1036067331 8:5396493-5396515 TTTTTTTCAGGAATGGCTGTTGG - Intergenic
1037723144 8:21461659-21461681 GGCATTGTAGGAATGGCTGGGGG - Intergenic
1038996923 8:32933730-32933752 GGTTCTATGGTAATGGCTGCTGG - Intergenic
1039766495 8:40633745-40633767 GATTCTATAGGAATAGCTTTAGG + Intronic
1039887109 8:41661175-41661197 GGTTTTGTAAGAATGCCTTTTGG - Intronic
1040635938 8:49273152-49273174 GCTTTTATTGGAATTGCTTTTGG - Intergenic
1041784801 8:61620027-61620049 TGTTTTATATGAATGAATGTGGG - Intronic
1044664918 8:94624929-94624951 GGTTTAATAGGTATGCCTGCAGG + Intergenic
1046605671 8:116369063-116369085 AGTTTGATAGGAATAGCTTTGGG + Intergenic
1046998824 8:120553152-120553174 TGTTTTACAGGAAGGACTGTTGG + Intronic
1050248532 9:3718053-3718075 GATCTTAGAGGAAAGGCTGTCGG - Intergenic
1054874066 9:70076830-70076852 AGTTTAATAGGAAAGGCTGAAGG - Intronic
1057124730 9:92608091-92608113 GGTGATATAGGGGTGGCTGTTGG - Intronic
1058177627 9:101755737-101755759 TGCTTGATAGGAATGGTTGTGGG - Intergenic
1203372272 Un_KI270442v1:319435-319457 AGTTTAATAGGAATAGCTTTAGG - Intergenic
1187534417 X:20125833-20125855 TTTTATTTAGGAATGGCTGTTGG - Exonic
1188770133 X:34143590-34143612 GGTTTTGTAGCAATTGCTTTTGG + Intergenic
1189752096 X:44232665-44232687 TTTTTTATAGGAATTGCTGGTGG - Exonic
1190529094 X:51357015-51357037 CTTTTTCTAGGAGTGGCTGTGGG - Intergenic
1190677907 X:52797749-52797771 CACTTAATAGGAATGGCTGTGGG - Exonic
1190958189 X:55218092-55218114 GCTTTTGTTGGAATGGCTTTTGG + Intronic
1191177885 X:57525164-57525186 GGTTTTATTGCAATTGCTTTTGG + Intergenic
1192306010 X:69960270-69960292 GATTTTGAAGGAATGGCTGAAGG + Intronic
1195568707 X:106375501-106375523 GGTTTTGTAGCAATTGCTTTTGG - Intergenic
1196894965 X:120326405-120326427 GATTTTAAAGGAATGGATATTGG + Intergenic
1197415714 X:126169658-126169680 GGTCTTATATGAATGGCTTCAGG + Intergenic
1197474885 X:126909730-126909752 GGTTTTATTGCAATTGCTTTTGG - Intergenic
1198854490 X:141002290-141002312 CACTTAATAGGAATGGCTGTGGG + Intergenic
1198877527 X:141242838-141242860 CACTTAATAGGAATGGCTGTGGG - Intergenic
1198908210 X:141585059-141585081 CACTTAATAGGAATGGCTGTGGG - Intronic
1198908581 X:141589365-141589387 CACTTAATAGGAATGGCTGTGGG + Intronic
1198918489 X:141698787-141698809 CACTTAATAGGAATGGCTGTGGG - Intergenic
1199033224 X:143025585-143025607 CACTTAATAGGAATGGCTGTGGG + Intergenic
1199075249 X:143517797-143517819 CACTTCATAGGAATGGCTGTGGG - Intergenic
1199094229 X:143721071-143721093 GACTTCATAGGAATGACTGTGGG - Exonic
1199214107 X:145247159-145247181 CACTTCATAGGAATGGCTGTGGG + Exonic
1201066100 Y:10095957-10095979 AGTTTAATAGGAATAGCTTTGGG + Intergenic
1201229759 Y:11852789-11852811 GGGTTGCAAGGAATGGCTGTGGG - Intergenic
1201991344 Y:20030925-20030947 GGTTTTAAAGAAATAGCTGGGGG + Intergenic