ID: 1020106377

View in Genome Browser
Species Human (GRCh38)
Location 7:5424015-5424037
Sequence TGGTTTTATAGGAATGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 229}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106377_1020106390 24 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106390 7:5424062-5424084 GTTTCCAGGCTCCCCTCGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1020106377_1020106391 25 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106391 7:5424063-5424085 TTTCCAGGCTCCCCTCGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1020106377_1020106386 10 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106377_1020106388 20 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106388 7:5424058-5424080 AGCAGTTTCCAGGCTCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 238
1020106377_1020106382 -8 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106382 7:5424030-5424052 TAAAACCAATTACGGACCTAGGG 0: 1
1: 0
2: 1
3: 1
4: 46
1020106377_1020106383 -7 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106383 7:5424031-5424053 AAAACCAATTACGGACCTAGGGG 0: 1
1: 0
2: 0
3: 0
4: 54
1020106377_1020106381 -9 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106381 7:5424029-5424051 ATAAAACCAATTACGGACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 73
1020106377_1020106389 23 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106389 7:5424061-5424083 AGTTTCCAGGCTCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106377 Original CRISPR TGGTTTTATAGGAATGGCTG TGG (reversed) Intronic
901773246 1:11541785-11541807 TGGTTTTAGAGGTATCACTGTGG - Intergenic
904155066 1:28476172-28476194 TGGTAATTTAGGAATGACTGAGG - Exonic
905704296 1:40042525-40042547 TGGAATTCTAGTAATGGCTGGGG + Intronic
907184128 1:52596177-52596199 TTAATTTTTAGGAATGGCTGTGG - Intergenic
907859565 1:58338639-58338661 TGGTTTTGTAGGAGTGACAGAGG + Intronic
908830598 1:68174672-68174694 TGATTTTAAGGGAAAGGCTGAGG - Intronic
909114873 1:71520762-71520784 TAGTGTCATAGGCATGGCTGGGG + Intronic
910665325 1:89719841-89719863 TAGTCTTATAGTAATGACTGTGG + Intronic
911153182 1:94614882-94614904 TGATTTGATAGGAAAGTCTGGGG - Intergenic
911753590 1:101526971-101526993 TGTTTCTATGGGAAAGGCTGAGG - Intergenic
912144409 1:106774398-106774420 TTGCTTTATAGGAGTGGCTGAGG + Intergenic
912524106 1:110268058-110268080 ATGTTATATAGGAATAGCTGGGG - Intronic
912547376 1:110460703-110460725 TGGGATTTTAGGAAAGGCTGAGG + Intergenic
912693696 1:111824020-111824042 TGGATTTTTAGGAAAAGCTGAGG + Intronic
915719040 1:157970558-157970580 TGGCTGTAAAGGAATGCCTGAGG + Intergenic
916617660 1:166459244-166459266 TTGTTATAAAGGAATGTCTGAGG + Intergenic
917009352 1:170453550-170453572 TTGGTGTATAGGAATGCCTGTGG + Intergenic
917257603 1:173132348-173132370 TGGTTGAATAGGAATAGCTCTGG - Intergenic
918802281 1:188986861-188986883 TGGAGCTATAGGAATGGGTGCGG + Intergenic
920426663 1:205882887-205882909 TGGTTTTCTAGTATTTGCTGAGG + Intergenic
921143529 1:212329463-212329485 TGGTATCATTGGAATGGATGGGG - Intronic
922814828 1:228441194-228441216 TGGTTTCAAAGGAATGGCTCTGG - Intergenic
922939022 1:229445077-229445099 TGGTTTTATTTTGATGGCTGTGG + Intronic
924732137 1:246722086-246722108 TTGCTTTAAAGGAATGCCTGAGG + Intergenic
1063037334 10:2299494-2299516 TGGTCTTCTTGGAATGGCTCTGG + Intergenic
1063074329 10:2700003-2700025 TGGTTTGATGGGATGGGCTGAGG - Intergenic
1063708301 10:8452439-8452461 TGAATTTTTAGAAATGGCTGAGG - Intergenic
1064907483 10:20362338-20362360 TTGTTATAAAGGAATGCCTGAGG - Intergenic
1065376627 10:25049880-25049902 TTGTTATATAGGAATACCTGAGG + Intronic
1065789761 10:29250035-29250057 TGGTTATAAAGGAATACCTGAGG - Intergenic
1070196700 10:74163856-74163878 TTGTTTTATAGGCTTGACTGAGG + Intronic
1071003388 10:80855926-80855948 TAGTTTTCTAGCAATAGCTGTGG + Intergenic
1071506943 10:86238274-86238296 TGGTTTTATAGGCAAGGCCCAGG + Intronic
1075456704 10:122589557-122589579 TGGCTGGAAAGGAATGGCTGGGG + Intronic
1076017816 10:127042500-127042522 TGGCTTTATAGGTAGTGCTGGGG + Intronic
1077529696 11:3089446-3089468 TGGCTTCTCAGGAATGGCTGGGG - Intronic
1078755598 11:14205878-14205900 TCTTTTTATTGGAATGGCTATGG + Intronic
1078764627 11:14282835-14282857 TGGTTATGTAGAAATGCCTGTGG - Intronic
1079729276 11:23920472-23920494 GGGCTTTAAAGGAATGTCTGTGG - Intergenic
1080964311 11:37196321-37196343 TTGCTTTATAGGAATACCTGAGG + Intergenic
1081634823 11:44714119-44714141 TGGTGTTATAGGAATGGCCAGGG + Intergenic
1081809625 11:45907643-45907665 GGGTGCTGTAGGAATGGCTGGGG - Intergenic
1082658462 11:55880034-55880056 TGGTTTAATGGGGATTGCTGGGG + Intergenic
1082951630 11:58822233-58822255 TTGGTGTATAGGAATGTCTGTGG + Intergenic
1083793200 11:64999219-64999241 TGTTTAACTAGGAATGGCTGTGG + Intergenic
1084442830 11:69185459-69185481 TGGTATTATAGAAATGGGTCAGG + Intergenic
1084525637 11:69696217-69696239 TGATTTAATGGGAATGGGTGTGG - Intergenic
1085678301 11:78546315-78546337 TTGTTTTTTTGGAATGGCTCCGG - Intronic
1090786362 11:130051489-130051511 TGTTTTTATAAGAATGGATCAGG + Intergenic
1092196800 12:6554730-6554752 TGGTTTCATAGGAAAAGCTCCGG - Intronic
1094130830 12:27073295-27073317 TTGTTGTATAGGAATGCTTGTGG + Intergenic
1094563688 12:31580085-31580107 TGGTTTTAAAGGAATATCTTAGG - Intronic
1094816886 12:34196149-34196171 TAGTTTAATAGGAATAGCTTTGG - Intergenic
1095551611 12:43448082-43448104 TAGTTTTATAGAAATGGCATTGG - Intronic
1097344674 12:58477522-58477544 TGGCTGAATAGGAATGGCTCCGG - Intergenic
1098205611 12:68106337-68106359 TGGCTTCTAAGGAATGGCTGTGG - Intergenic
1098729870 12:74021942-74021964 TGCTTTTATAGGAAAGGTTGTGG + Intergenic
1099319765 12:81131437-81131459 TTGATGTATAGGAATGCCTGTGG + Intronic
1100490173 12:95071651-95071673 TTGTTTTATAGAAATGGTGGGGG - Intronic
1101557560 12:105824558-105824580 TTGCCTTATAGGAATAGCTGAGG + Intergenic
1102242587 12:111334435-111334457 TGGTTCTGTGGGACTGGCTGTGG - Exonic
1106698516 13:32204421-32204443 TAATTTTATAGCAATGGCTTTGG - Intronic
1106765077 13:32905584-32905606 TGGTTTTATAGCAAATGCTTAGG + Intergenic
1106779895 13:33048691-33048713 TTGTGTTCTAGGTATGGCTGAGG - Intronic
1107637114 13:42403622-42403644 TGGTTTTGTTAGAATGACTGAGG + Intergenic
1108177815 13:47811734-47811756 GGGTTTTATAGGGAAGGCAGAGG - Intergenic
1109144984 13:58768334-58768356 TGGTTTTATGAGAAAGGATGGGG - Intergenic
1109329867 13:60916208-60916230 TGGTGTTAAAGGAATAGTTGAGG - Intergenic
1111146759 13:84191944-84191966 TGGTTGTATAGAAACCGCTGAGG + Intergenic
1111700276 13:91678419-91678441 TAGCTTTATAGCAATGGCTAAGG - Intronic
1113705324 13:112427551-112427573 TGGTTTCATAGAAATGGGTTGGG + Intronic
1113800611 13:113084596-113084618 TGGCCTTCTAAGAATGGCTGCGG + Intronic
1120478546 14:85020189-85020211 TTGTTGTATAGGAATGCTTGTGG + Intergenic
1121672452 14:95723189-95723211 TTGTTATAAAGGAATGCCTGAGG - Intergenic
1124474771 15:30023252-30023274 TGGCTGAATAGGAATAGCTGAGG - Intergenic
1125235853 15:37512564-37512586 TGTCTTTGTATGAATGGCTGTGG + Intergenic
1126286861 15:47022846-47022868 TTGTTATATAGGAATACCTGAGG - Intergenic
1127266887 15:57369620-57369642 TGGTGTTTTGGGGATGGCTGAGG + Intergenic
1128104369 15:65032339-65032361 TGGTGTTACTGTAATGGCTGAGG + Intergenic
1128770454 15:70277955-70277977 TGGTTTTTAAAGTATGGCTGAGG + Intergenic
1128976725 15:72159695-72159717 TGGGATTATAGGAATGACTTGGG + Intergenic
1130080392 15:80727817-80727839 TGGTATTAGGGGAAGGGCTGGGG + Intronic
1130745271 15:86646669-86646691 TGCTTTTATAGGAAGAGCTCTGG + Intronic
1130965586 15:88695365-88695387 TGGTGTTAGAGGAAGGGCGGGGG - Intergenic
1136265100 16:29111555-29111577 TGGTAGTATGGGAAGGGCTGGGG + Intergenic
1136290387 16:29268120-29268142 TGGTGTGATCGGGATGGCTGGGG - Intergenic
1139597369 16:67966339-67966361 TGGAATTTTTGGAATGGCTGAGG - Intronic
1141471823 16:84243876-84243898 TGGTTCTATCTGATTGGCTGGGG - Intergenic
1143161768 17:4876546-4876568 TGCTTTTATTGGCATGGATGTGG + Intronic
1144126066 17:12204097-12204119 TGGTAGTATAGGGCTGGCTGCGG - Intergenic
1146417871 17:32653682-32653704 AGGCATTGTAGGAATGGCTGAGG - Intronic
1148560753 17:48604510-48604532 CGGATTTAAAGGAATGGGTGGGG + Exonic
1148918622 17:51007315-51007337 TCGTTTGATAGGAATGGGTCGGG - Exonic
1149394197 17:56222119-56222141 TTGTTTTAGATGTATGGCTGAGG + Intronic
1153776839 18:8462056-8462078 TGGTTTTCTAGACAGGGCTGAGG + Intergenic
1153799215 18:8654641-8654663 TGGTGTTATAATAATCGCTGAGG + Intergenic
1154110102 18:11560333-11560355 TCGTTGTAAAGGAATGTCTGAGG + Intergenic
1155484029 18:26321279-26321301 CGTTTTTAAAGGAATGGTTGAGG + Intronic
1159384151 18:67700771-67700793 TGGCTTTACAGGAATACCTGAGG - Intergenic
1163207870 19:15816743-15816765 TGGTTTTGAAGGACTGGGTGGGG - Intergenic
1163774065 19:19207739-19207761 TGGTTTTATATGGCTGGGTGTGG + Intergenic
1164202306 19:23029059-23029081 TTGTTTTATAGAAAGGGTTGGGG + Intergenic
1168170599 19:54585870-54585892 TGGTCGAATAGGAATGGCTCCGG - Intronic
925156667 2:1653422-1653444 TGGTTTAATAGGAATCTCTGGGG - Intronic
925540448 2:4960956-4960978 TGGTTTCTCAGGAATGCCTGTGG + Intergenic
925906318 2:8541645-8541667 TGCTTTTAGAGGAGTGACTGTGG + Intergenic
927231356 2:20827026-20827048 TTGCTTTATAGGAATACCTGAGG - Intergenic
927432809 2:23041318-23041340 TGGTTTTGTAGAAAATGCTGTGG - Intergenic
927524805 2:23728919-23728941 TGGTTTTGCAAGCATGGCTGGGG + Intergenic
928794813 2:35005213-35005235 TGGTGTTATAGGAATGCCTGTGG - Intergenic
933280810 2:80330836-80330858 TGAGTTTAGAGGAATGGATGTGG + Intronic
933411579 2:81931874-81931896 TTATTTTTTAGAAATGGCTGTGG + Intergenic
936111289 2:109667497-109667519 TGGAGTCATAGGCATGGCTGGGG + Intergenic
937827326 2:126381079-126381101 TTGTTTTATAGGATTTGCTAGGG + Intergenic
938721276 2:134069249-134069271 TGGTTTATTAGGAATGCCAGTGG + Intergenic
939334080 2:140802792-140802814 TGAATTTATAGGATTGGCTCTGG - Intronic
942584576 2:177461186-177461208 TGATTTCATTGGAATGGCTTTGG + Intronic
944019392 2:195083542-195083564 TGGGCTTGGAGGAATGGCTGGGG + Intergenic
945019142 2:205553661-205553683 CAGTTTTATAGCAATGGCTTAGG - Intronic
945534044 2:210989701-210989723 TGGTTTTTGAGCCATGGCTGGGG - Intergenic
945917959 2:215724424-215724446 TATTTTTAAAGAAATGGCTGAGG - Intergenic
948584740 2:239012318-239012340 GGGTTTAAGAGGAATGGATGGGG + Intergenic
1170825761 20:19793778-19793800 TCGTTTTGTAGGAAAAGCTGTGG + Intergenic
1171778813 20:29398623-29398645 TAGTTTAATAGGAATAGCTTTGG - Intergenic
1171897242 20:30819244-30819266 TAGTTTAATAGGAATAGCTTTGG + Intergenic
1172208246 20:33179838-33179860 TGGGTCTACAGGCATGGCTGGGG + Intronic
1173031259 20:39362789-39362811 TGTTTTTATAGATATTGCTGAGG + Intergenic
1175652040 20:60733829-60733851 TTGTTTTCCAGGAAAGGCTGAGG + Intergenic
1179026371 21:37682437-37682459 TGGTTTTATAGGAATAGAGGAGG + Intronic
1180621206 22:17163563-17163585 TGGTCATATAGGTGTGGCTGGGG - Intronic
1180926212 22:19556765-19556787 TTGTTTTGTTGGAATTGCTGAGG - Intergenic
1183612161 22:38916467-38916489 TGTTTTTATAGCAATGCATGTGG - Intergenic
1184151753 22:42643607-42643629 TGGGTCTAAAGGAAGGGCTGTGG + Intronic
950271788 3:11622276-11622298 TGGGTATCTAGCAATGGCTGGGG - Intronic
955027022 3:55178103-55178125 TGGTTTCATAGGAACGGCATAGG - Intergenic
955617562 3:60825364-60825386 TGGTTTTATAGGCATCAGTGTGG + Intronic
956284153 3:67590735-67590757 TTGTTTTAAAGAAATAGCTGAGG - Intronic
956395595 3:68822948-68822970 TGGGTTTAAAAGAATGGCTTTGG + Intronic
956792764 3:72692983-72693005 TTGTTTTCTAGGAGAGGCTGGGG - Intergenic
957086328 3:75681931-75681953 TAGTTTAATAGGAATAGCTTTGG + Intergenic
957114191 3:76003492-76003514 TGTTTTTATGTGGATGGCTGAGG - Intronic
957788318 3:84908675-84908697 TGGTATTATAGTTTTGGCTGGGG + Intergenic
957953195 3:87150356-87150378 TGGTTTTATGGGCCAGGCTGTGG - Intergenic
958195187 3:90235155-90235177 TGATCTTAGAGGCATGGCTGGGG + Intergenic
958878249 3:99639670-99639692 TGGTTTTACAGAAGTGGCTGTGG - Intronic
959205441 3:103300993-103301015 TTGTTTTAAAGGAATGGTTGTGG + Intergenic
959668688 3:108949621-108949643 CTATTTTATAGGAATGGCTATGG - Intronic
962170280 3:133094496-133094518 TTGTTTTATCGGTATGCCTGGGG - Intronic
962321616 3:134395333-134395355 TGCTTTCAGAGGAAAGGCTGGGG + Intergenic
963706000 3:148688995-148689017 TGGTTCTTGAGGAATGGCTGAGG - Intergenic
964190189 3:153992428-153992450 TGGTTTCATAGGCCTGGCTCAGG + Intergenic
967376673 3:188811555-188811577 TTGTTTTATAGCAATTACTGGGG + Intronic
967445891 3:189566077-189566099 TTGTTTTCTGGGATTGGCTGGGG + Intergenic
970252639 4:14132083-14132105 GGGAGTTATAGGAATGACTGTGG + Intergenic
970777636 4:19695105-19695127 GGGTTTTATAGAAATGCATGAGG - Intergenic
970934223 4:21549639-21549661 TTGTTATAAAGGAATTGCTGGGG - Intronic
970966884 4:21938023-21938045 TGGTTTTGTGGGAATGTGTGGGG - Intronic
971367334 4:25987946-25987968 TGTTTTCTTAGGAAAGGCTGAGG + Intergenic
975496668 4:75043182-75043204 TGGTTTTATAACTATGCCTGGGG + Intronic
976058283 4:81095305-81095327 TGGTTTTACAGCAAGGGCAGAGG - Intronic
978063096 4:104363276-104363298 TGGTTATCTAGGAATGGAAGTGG + Intergenic
978765177 4:112398035-112398057 TGATTGTAGAGGAATGGCTAGGG + Intronic
979660635 4:123250398-123250420 TTGTTATATAAGAATGGCAGGGG + Intronic
980186091 4:129462938-129462960 TGCTCTTATAGGACTTGCTGAGG + Intergenic
981065740 4:140483514-140483536 TGGTTTCATATGAATTGCAGGGG - Intronic
982797612 4:159664315-159664337 TGGTTTTGTGGGCCTGGCTGAGG - Intergenic
982857848 4:160407849-160407871 TGATGTGATAGGAATTGCTGGGG + Intergenic
984937095 4:184898871-184898893 TGGGGTGATAGGAGTGGCTGTGG - Intergenic
986856707 5:11877023-11877045 TTATTTTATAGCAATGACTGAGG + Intronic
987380607 5:17282284-17282306 TCTTTTTAGAGGAAGGGCTGGGG - Intergenic
989674852 5:43961756-43961778 TTGTTGTATAGGAATGCTTGTGG + Intergenic
990139915 5:52691113-52691135 TGGCTTTACACGAATGTCTGTGG - Intergenic
991977716 5:72199364-72199386 TGGTTTCATAAGAGTAGCTGGGG - Exonic
992859910 5:80899353-80899375 GGGTTATATAGGGGTGGCTGTGG + Intergenic
993041450 5:82819323-82819345 TGGTTTTATAGGCTAGGCAGAGG - Intergenic
993163321 5:84317994-84318016 TTGCTGTATAGGAATGTCTGTGG - Intronic
994988319 5:106966362-106966384 TGCATTTAAAAGAATGGCTGAGG - Intergenic
998314015 5:141163227-141163249 TGGTTTAATAGGAAGGGCTCTGG - Intergenic
999367434 5:151032288-151032310 TGGTTCTGTAGGCCTGGCTGTGG + Exonic
1001236812 5:170036727-170036749 TGGTTTTATGGGGCTGACTGTGG - Intronic
1004772089 6:18795620-18795642 TGGCTATATAGGAATACCTGAGG + Intergenic
1009026488 6:58006700-58006722 TGGTTTGAAAACAATGGCTGTGG + Intergenic
1009202038 6:60758173-60758195 TGGTTTGAAAACAATGGCTGTGG + Intergenic
1009355190 6:62735332-62735354 TGGTTTTAGAGGCTTGACTGGGG + Intergenic
1011188634 6:84706890-84706912 AAGGTTAATAGGAATGGCTGGGG - Intronic
1012642769 6:101640712-101640734 TGATTTTATAGGTATAGTTGTGG + Intronic
1017576999 6:155816271-155816293 TGGTTTTGTAGGAAAGGCCTGGG - Intergenic
1018053624 6:160032974-160032996 TTGTTTTATTTGAATGTCTGTGG + Exonic
1019467522 7:1197688-1197710 TTGTTTTAAAGAAATGGCTAAGG + Intergenic
1019834378 7:3367462-3367484 TGGTTTTCTAGTATTGACTGAGG - Intronic
1020014465 7:4822788-4822810 AGGTTTTTTACCAATGGCTGTGG - Intronic
1020106377 7:5424015-5424037 TGGTTTTATAGGAATGGCTGTGG - Intronic
1022447603 7:30482726-30482748 TTGTTTTGTAGAAGTGGCTGGGG - Intergenic
1023284220 7:38602570-38602592 TGCTTTTATAGCAATCCCTGTGG + Intronic
1023285610 7:38615837-38615859 TGGTTCTGTAGCAAGGGCTGGGG + Intronic
1025641157 7:63370959-63370981 TTGTTTTATTTGAATGGCTATGG + Intergenic
1029434661 7:100556122-100556144 TGGTCTTAGAGGGATGGATGAGG - Intronic
1032312806 7:130803869-130803891 TGGTTGTCTAGGATTTGCTGGGG - Intergenic
1032650696 7:133874912-133874934 TGGCTCTAAAGGAGTGGCTGAGG + Intronic
1037723145 8:21461660-21461682 TGGCATTGTAGGAATGGCTGGGG - Intergenic
1039674222 8:39642286-39642308 TGGTTTTGTTGCAATTGCTGTGG + Intronic
1041680422 8:60583385-60583407 TGTTTTTTTAAGAATTGCTGGGG - Intronic
1044108753 8:88245337-88245359 TGATGTTTTAGGAATGGCTAAGG - Intronic
1044303083 8:90607986-90608008 GGGTTTTATATGTATGGATGAGG - Intergenic
1044800061 8:95945042-95945064 GGGTTTTACTGGCATGGCTGGGG - Intergenic
1045853682 8:106736064-106736086 TGGTTTTATGTGAATTACTGAGG - Intronic
1046538007 8:115541250-115541272 TGGTTACATAGGGATGGCTTAGG + Intronic
1046605670 8:116369062-116369084 TAGTTTGATAGGAATAGCTTTGG + Intergenic
1046618747 8:116505394-116505416 TGGTCTTAGAGCAATGTCTGAGG - Intergenic
1047213958 8:122862200-122862222 TGGCTTTGTGGGAGTGGCTGAGG - Intronic
1047301516 8:123617528-123617550 TGGTTGAATAAGAGTGGCTGGGG + Intergenic
1051390506 9:16558177-16558199 TGGTTTTCTAGGCCTGGCTAAGG - Intronic
1053749803 9:41241062-41241084 TAGTTTAATAGGAATAGCTTTGG + Intergenic
1054255308 9:62805398-62805420 TAGTTTAATAGGAATAGCTTTGG + Intergenic
1054336001 9:63810209-63810231 TAGTTTAATAGGAATAGCTTTGG - Intergenic
1054848615 9:69822827-69822849 TGGTTTTAGAAGGAAGGCTGGGG + Intronic
1058884746 9:109314645-109314667 TTGTTTTAAAAGAAAGGCTGAGG - Intronic
1059020666 9:110573166-110573188 TTTTTTTATAGGAAGGGGTGGGG - Intronic
1059953309 9:119490256-119490278 TTGTTATAAAGGAATGTCTGAGG + Intergenic
1188475298 X:30585897-30585919 TTGTTATAAAGGAATGCCTGAGG + Intergenic
1189845456 X:45132336-45132358 TTGTTATAAAGGAATGCCTGAGG + Intergenic
1189857295 X:45236186-45236208 TAGTTTTCCAGGAATGGTTGAGG + Intergenic
1190529095 X:51357016-51357038 TCTTTTTCTAGGAGTGGCTGTGG - Intergenic
1190677908 X:52797750-52797772 TCACTTAATAGGAATGGCTGTGG - Exonic
1191591231 X:62887825-62887847 TGGTTGAATAGGAATAGCTCTGG + Intergenic
1196408752 X:115394149-115394171 TTCTTTAATAGGAATGGTTGGGG + Intergenic
1196432777 X:115644658-115644680 TGGTTTTATAGAAATATCAGTGG - Intronic
1196636273 X:118006558-118006580 TGTTTTTCTAAGAATAGCTGTGG - Intronic
1197007147 X:121515173-121515195 AGGCTTAATAGGAATGGGTGAGG - Intergenic
1198854489 X:141002289-141002311 TCACTTAATAGGAATGGCTGTGG + Intergenic
1198856299 X:141020683-141020705 TGGTGTTATAAGAATGCTTGTGG - Intergenic
1198875835 X:141225426-141225448 TGGTGTTATAAGAATGCTTGTGG + Intergenic
1198877528 X:141242839-141242861 TCACTTAATAGGAATGGCTGTGG - Intergenic
1198906393 X:141566684-141566706 TGGTGTTATAAGAATGCTTGTGG + Intergenic
1198908211 X:141585060-141585082 TCACTTAATAGGAATGGCTGTGG - Intronic
1198908580 X:141589364-141589386 TCACTTAATAGGAATGGCTGTGG + Intronic
1198918490 X:141698788-141698810 TCACTTAATAGGAATGGCTGTGG - Intergenic
1199033223 X:143025584-143025606 TCACTTAATAGGAATGGCTGTGG + Intergenic
1199075250 X:143517798-143517820 TCACTTCATAGGAATGGCTGTGG - Intergenic
1199094230 X:143721072-143721094 TGACTTCATAGGAATGACTGTGG - Exonic
1199214106 X:145247158-145247180 TCACTTCATAGGAATGGCTGTGG + Exonic
1201066099 Y:10095956-10095978 TAGTTTAATAGGAATAGCTTTGG + Intergenic
1201991343 Y:20030924-20030946 TGGTTTTAAAGAAATAGCTGGGG + Intergenic