ID: 1020106378

View in Genome Browser
Species Human (GRCh38)
Location 7:5424021-5424043
Sequence CGTAATTGGTTTTATAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106378_1020106390 18 Left 1020106378 7:5424021-5424043 CCATTCCTATAAAACCAATTACG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1020106390 7:5424062-5424084 GTTTCCAGGCTCCCCTCGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1020106378_1020106389 17 Left 1020106378 7:5424021-5424043 CCATTCCTATAAAACCAATTACG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1020106389 7:5424061-5424083 AGTTTCCAGGCTCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 144
1020106378_1020106388 14 Left 1020106378 7:5424021-5424043 CCATTCCTATAAAACCAATTACG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1020106388 7:5424058-5424080 AGCAGTTTCCAGGCTCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 238
1020106378_1020106391 19 Left 1020106378 7:5424021-5424043 CCATTCCTATAAAACCAATTACG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1020106391 7:5424063-5424085 TTTCCAGGCTCCCCTCGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1020106378_1020106386 4 Left 1020106378 7:5424021-5424043 CCATTCCTATAAAACCAATTACG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106378 Original CRISPR CGTAATTGGTTTTATAGGAA TGG (reversed) Intronic
900459377 1:2794670-2794692 CGTAATTGATTTTAAATGGAAGG + Intronic
900880244 1:5376462-5376484 GGTAATTGGTTTTACAGAGACGG - Intergenic
907592947 1:55693218-55693240 GGTAATTTGTTTTATAGCCAGGG - Intergenic
908187776 1:61669047-61669069 CTTAATTATTTTTATTGGAATGG + Intergenic
909248524 1:73322066-73322088 CGGAATGGGTTTTATAAAAAAGG - Intergenic
909842788 1:80349864-80349886 CTTAATTGGTTTCCAAGGAAAGG - Intergenic
911471431 1:98323679-98323701 CATAATTGCTTTTATGAGAATGG + Intergenic
911981094 1:104567920-104567942 AGTCATTGGTTCTAAAGGAAAGG + Intergenic
913044273 1:115060469-115060491 AGTATTTGCTTTTATAGGCAAGG - Exonic
918276400 1:182957294-182957316 GTTAATTGGTTTTATCAGAATGG + Intergenic
1066775262 10:38880576-38880598 TGTAATTGATTTTAATGGAATGG + Intergenic
1068889880 10:62137717-62137739 AGTCATTGGATTTATAGAAAAGG - Intergenic
1072023055 10:91423913-91423935 AATGATTGGTTTTATAGAAATGG + Intronic
1074434495 10:113422415-113422437 CATAATTGAATTTCTAGGAATGG - Intergenic
1074793591 10:116917854-116917876 CTTAATTGGTTTTAAGGAAAAGG + Intronic
1078048579 11:7941148-7941170 CGTATTTGGTTTTATAGGCCTGG - Intergenic
1078508986 11:11971809-11971831 CTTAATTGTTTTTCTAGGTACGG + Intronic
1081257672 11:40916786-40916808 CTTAATTGGTCTTAGAGGGAGGG + Intronic
1084057640 11:66646690-66646712 AGTAGTTGGTTTTATAACAAAGG - Intronic
1087040275 11:93792541-93792563 TGTAACTGGTTTTATAACAAGGG - Intronic
1087539744 11:99501265-99501287 AGCAATTGGCTTTATAGTAATGG + Intronic
1092666724 12:10808727-10808749 CATGATTGATTTTATAGCAAGGG + Intergenic
1095371535 12:41473436-41473458 TTCTATTGGTTTTATAGGAAAGG - Intronic
1100691000 12:97038385-97038407 CGCTGTTGTTTTTATAGGAATGG - Intergenic
1100829822 12:98507577-98507599 CGGAAAGAGTTTTATAGGAAAGG + Intergenic
1106854865 13:33840202-33840224 TGTAATTAGTCTTAGAGGAAGGG - Intronic
1107326838 13:39253304-39253326 CCTAATTTTTATTATAGGAAAGG - Intergenic
1109856363 13:68133056-68133078 CTTAATTGCTTTTATCGGAGTGG + Intergenic
1112727298 13:102319198-102319220 AGTAATTCAATTTATAGGAAAGG + Intronic
1115896741 14:38097162-38097184 TGTGGTTGGTTTTATATGAATGG - Intergenic
1118238133 14:64029522-64029544 GGTAGTTGGTTTTATTGCAAAGG + Intronic
1126430989 15:48584334-48584356 CGTGATCAGTTTTCTAGGAATGG + Intronic
1126661532 15:51038118-51038140 TGTATTTGCTTTTATAGGAGAGG + Intergenic
1126924209 15:53564664-53564686 CACATTTGGTCTTATAGGAATGG + Intronic
1133648470 16:7786896-7786918 TAAAATTGGTTTTATAGGCAAGG - Intergenic
1133984135 16:10655112-10655134 CTCAATTGTTTTTTTAGGAAAGG - Intronic
1137090782 16:36187798-36187820 CATCATTGGATTTAAAGGAATGG - Intergenic
1140363342 16:74363020-74363042 TGTAAGTGGGTCTATAGGAAGGG - Intergenic
1144899410 17:18570051-18570073 CGTTAGTAGTTTGATAGGAATGG - Intergenic
1145329280 17:21857522-21857544 TGTAATTGATTTGAAAGGAATGG + Intergenic
1145695379 17:26783228-26783250 TGTAATTGATTTGAAAGGAATGG + Intergenic
1145695790 17:26786662-26786684 TGTAATTGGTTTGAATGGAATGG + Intergenic
1145703469 17:26851026-26851048 TGTAATTGATTTGAAAGGAAAGG + Intergenic
1149278526 17:55073396-55073418 GCTAATTTGTTTTATGGGAATGG + Intronic
1150568917 17:66368834-66368856 CTTAGTTGGTTTTAGAGTAAAGG + Intronic
1203200341 17_KI270729v1_random:269698-269720 TGTAATTGATTTGAAAGGAATGG + Intergenic
1203209935 17_KI270730v1_random:70399-70421 TGTAATTGATTTGAAAGGAATGG + Intergenic
1155167236 18:23241051-23241073 AGTAATTGCTTTTGCAGGAAGGG - Intronic
1159307633 18:66664982-66665004 TTTAATTGGATTTCTAGGAAGGG + Intergenic
925698108 2:6604239-6604261 GAAAATTGGTTTTCTAGGAATGG + Intergenic
925766324 2:7239291-7239313 AGTAATTCGCATTATAGGAAAGG + Intergenic
926149207 2:10415382-10415404 AATAACTGGTTTTATGGGAAGGG - Intronic
926573472 2:14554990-14555012 CGTAAGTGTTTTTATTGAAACGG - Intergenic
927999053 2:27507184-27507206 AGTGATTGGCTATATAGGAAAGG - Intronic
930482697 2:51969238-51969260 CTTAAATGGTTTTATAAGAAAGG - Intergenic
933856487 2:86419147-86419169 CTTATTTGTTTTTATTGGAAGGG - Intergenic
935690580 2:105727755-105727777 AGTAATTTGTTGTATAGCAAGGG + Intergenic
935932519 2:108143645-108143667 CATAATTGGTGTTCTAAGAAAGG + Intergenic
939226784 2:139374740-139374762 CGTAATTTGTTTTCAAGTAAAGG + Intergenic
940363439 2:152820001-152820023 TGTACATGGTTTTATTGGAATGG - Intergenic
943396931 2:187350739-187350761 GTTCATTTGTTTTATAGGAATGG + Intronic
944179993 2:196880390-196880412 TGTCATTTGTTTTATATGAAGGG - Intronic
948314590 2:237017690-237017712 CTTATTTGGTTTTCTGGGAAAGG - Intergenic
948314670 2:237018207-237018229 CTTATTTGGTTTTCTGGGAAGGG + Intergenic
1170920441 20:20673683-20673705 TGCAGGTGGTTTTATAGGAAAGG + Intronic
1173336207 20:42114133-42114155 AGTGATTGGTTTTAGAGAAATGG + Intronic
1173552819 20:43945270-43945292 CGTTATTGTTTTTATAAAAATGG + Intronic
1177039328 21:16087363-16087385 CTTAACTGGATTTATAGGAAAGG + Intergenic
1178203653 21:30438240-30438262 TGAAATTGCTTATATAGGAATGG + Intergenic
1182534753 22:30992434-30992456 GGTAATTTGTTGTATAGCAAGGG + Intergenic
949929229 3:9065209-9065231 AGGAATTGTTTTTATAGGCAAGG - Intronic
955027023 3:55178109-55178131 CTAAACTGGTTTCATAGGAACGG - Intergenic
956252416 3:67248619-67248641 CTTAGTTGGTACTATAGGAAAGG - Intergenic
961359733 3:126359473-126359495 CCCAAATGGTTTTATAGGCAAGG - Intergenic
962997872 3:140649612-140649634 AGACATTGGTTTTCTAGGAAAGG + Intergenic
963093447 3:141509226-141509248 GATAACTGCTTTTATAGGAAAGG + Intronic
964499810 3:157336265-157336287 AGTAATTGGTTTTGGGGGAAAGG - Intronic
967085494 3:186091477-186091499 GATAATTGGCCTTATAGGAAGGG - Intronic
967703080 3:192617527-192617549 TGAAATTGGTGTTATAAGAATGG + Intronic
970188470 4:13486510-13486532 CATATGTGGTTTTATATGAAGGG + Intergenic
971602429 4:28611066-28611088 GGTAATTATTTTTATATGAATGG + Intergenic
971848555 4:31951784-31951806 TGTACTTGGTTTTATAGTCAAGG + Intergenic
979150454 4:117307617-117307639 AGTAATATGTTTAATAGGAATGG + Intergenic
980175875 4:129343615-129343637 CGTAAATGGTTTTGTAGTTAAGG + Intergenic
981119199 4:141029556-141029578 TGTTATGGGTTTTATGGGAATGG + Intronic
982530676 4:156538872-156538894 CATAATTGATTTTAAAGAAAAGG + Intergenic
982697436 4:158619224-158619246 CTTAATCAGTATTATAGGAATGG - Intronic
990048389 5:51463040-51463062 TGTAAATGTTTTTATAGAAATGG - Intergenic
991335628 5:65543490-65543512 CATCATTGGTTTTACAAGAATGG + Intronic
993152248 5:84175362-84175384 TATAATTGTTTTTAAAGGAAGGG + Intronic
993648491 5:90488875-90488897 GGGAAGTGGTTTTATAGGAAAGG + Intronic
997986970 5:138509589-138509611 CCTAATTTTTTTTATAGAAATGG - Intronic
1006266875 6:32932885-32932907 GGTTTTTTGTTTTATAGGAAAGG - Intergenic
1008831407 6:55767316-55767338 TATAATTGGTTTTATAGAACTGG - Intronic
1009662113 6:66627140-66627162 CGTAATTTCTTTTGTAGGACTGG + Intergenic
1010115032 6:72295025-72295047 CTTAATTGGTTGTATAAAAATGG + Intronic
1011393917 6:86885548-86885570 CATTAGTAGTTTTATAGGAATGG + Intergenic
1015367228 6:132409743-132409765 TGAAATTGGTTATATAGCAATGG + Intergenic
1015946744 6:138510390-138510412 TGTACTTGGTTTTCTAGTAATGG + Intronic
1016240947 6:141929803-141929825 TGCAATTGTTATTATAGGAATGG - Intergenic
1017899450 6:158706424-158706446 TGTAAATGGTTTTTTTGGAATGG + Intronic
1020106378 7:5424021-5424043 CGTAATTGGTTTTATAGGAATGG - Intronic
1021135576 7:16960780-16960802 TGGAATAGTTTTTATAGGAATGG + Intergenic
1021398691 7:20183546-20183568 GGTAATTTGTTTTGTAGAAATGG + Intronic
1024173808 7:46817651-46817673 TCTAATAAGTTTTATAGGAAGGG - Intergenic
1024518137 7:50278476-50278498 TGTCTTTGGATTTATAGGAATGG + Intergenic
1026190251 7:68119113-68119135 CGAAATTGAGATTATAGGAAGGG + Intergenic
1027395619 7:77750756-77750778 AGTTTTTGGTTTTCTAGGAACGG + Intronic
1027651526 7:80874378-80874400 AGTAATTGTTTTTACAGCAAGGG + Intronic
1029983222 7:104898462-104898484 ATTAATTGGTTTTATACAAAGGG + Intronic
1035619496 8:1027114-1027136 CGTAAATTGTTTTACAGAAAAGG + Intergenic
1036472921 8:9066645-9066667 GGTCATTGTTTTTAAAGGAAGGG + Intronic
1039226515 8:35394103-35394125 CATGATTGGTTTCATAGGAAAGG - Intronic
1042351832 8:67784866-67784888 CTTAATAATTTTTATAGGAAAGG - Intergenic
1044818472 8:96137621-96137643 CTAGATTGGTTTTAAAGGAAAGG + Intergenic
1051136841 9:13932543-13932565 AGTAATGGGTCTTATAGGACTGG - Intergenic
1051353006 9:16215894-16215916 TGTAACTTGTTTTGTAGGAATGG - Exonic
1051712394 9:19945390-19945412 GGTAATTGTTTTTACACGAAAGG - Intergenic
1055682050 9:78725264-78725286 AGTAATTGGTCTCAAAGGAAAGG + Intergenic
1056866932 9:90235762-90235784 TGTAATAGTTTCTATAGGAATGG + Intergenic
1056888280 9:90465303-90465325 CATAATTTGTTATATAAGAAGGG - Intergenic
1058326708 9:103707369-103707391 AGTCATTCCTTTTATAGGAAAGG + Intergenic
1203674401 Un_KI270756v1:9645-9667 TGTAATTGATTTGAAAGGAATGG - Intergenic
1203677535 Un_KI270756v1:35703-35725 TGTAATTGATTTTAATGGAATGG - Intergenic
1187124001 X:16436443-16436465 TGTAATTGCTTTTCTAGGAAGGG + Intergenic
1189367367 X:40399211-40399233 CACAATTGGTTATATAGGAAAGG + Intergenic
1196323600 X:114373502-114373524 CATAATTGGTTTTCAAGGAGAGG + Intergenic
1201196228 Y:11497140-11497162 TGTAATTGGTTTGAAAGGAAAGG + Intergenic
1201207521 Y:11646581-11646603 CGTAATTGATTTGAAAGGAAGGG + Intergenic
1201218105 Y:11740916-11740938 TGTAATTGATTTGAAAGGAATGG + Intergenic