ID: 1020106380

View in Genome Browser
Species Human (GRCh38)
Location 7:5424026-5424048
Sequence AGGTCCGTAATTGGTTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106380_1020106386 -1 Left 1020106380 7:5424026-5424048 CCTATAAAACCAATTACGGACCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106380_1020106388 9 Left 1020106380 7:5424026-5424048 CCTATAAAACCAATTACGGACCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1020106388 7:5424058-5424080 AGCAGTTTCCAGGCTCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 238
1020106380_1020106390 13 Left 1020106380 7:5424026-5424048 CCTATAAAACCAATTACGGACCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1020106390 7:5424062-5424084 GTTTCCAGGCTCCCCTCGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1020106380_1020106389 12 Left 1020106380 7:5424026-5424048 CCTATAAAACCAATTACGGACCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1020106389 7:5424061-5424083 AGTTTCCAGGCTCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 144
1020106380_1020106391 14 Left 1020106380 7:5424026-5424048 CCTATAAAACCAATTACGGACCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1020106391 7:5424063-5424085 TTTCCAGGCTCCCCTCGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106380 Original CRISPR AGGTCCGTAATTGGTTTTAT AGG (reversed) Intronic
901256739 1:7835295-7835317 AAGTCAATAATTGGCTTTATTGG + Intronic
905286288 1:36882584-36882606 AGGTCAGTGAGTGGTTTTCTGGG - Intronic
912226981 1:107745126-107745148 AGGACGGCAAATGGTTTTATTGG - Intronic
916930778 1:169576149-169576171 AAGTCCAAAATGGGTTTTATTGG - Intronic
918308185 1:183266124-183266146 AAGTCTGAAATAGGTTTTATTGG - Intronic
919279328 1:195466846-195466868 AGGTCCCTAATTGTTTTTGATGG + Intergenic
1063563885 10:7155042-7155064 AGGTCAATATTTGGTTTCATTGG - Intergenic
1072792389 10:98327637-98327659 AGGTCCAGAATTGGTATTAAGGG + Intergenic
1074638915 10:115355718-115355740 AGGTGCTTAATGGGTTTTGTTGG + Intronic
1075993730 10:126859782-126859804 AGGTCCAAAATGGGTTTTACTGG + Intergenic
1083062395 11:59887628-59887650 AGTTCTGTATTTTGTTTTATTGG + Intergenic
1084516392 11:69640110-69640132 AGGTTCCTAATTGGTTTTGTTGG - Intergenic
1097920363 12:65066041-65066063 ATGTCCTAAATTGGTTTTGTGGG - Intronic
1098102193 12:67029715-67029737 ATGTCCGTTATTGCTTTTGTGGG - Intergenic
1099382672 12:81974871-81974893 AGGTCAGAAATTGGTATTACTGG + Intergenic
1109856362 13:68133051-68133073 AGATTCTTAATTGCTTTTATCGG + Intergenic
1111362549 13:87193888-87193910 TGGTCAGTAATTTGTTTTTTGGG + Intergenic
1113088161 13:106589486-106589508 AAGTATGTATTTGGTTTTATTGG + Intergenic
1114520805 14:23334112-23334134 AGGTCCTTAATTTCTTTCATTGG + Intergenic
1118714903 14:68552301-68552323 GGGTCCGTTCTTGGTTATATAGG + Intronic
1130525054 15:84698551-84698573 AGGTCCTGCATTGATTTTATTGG - Intronic
1130829490 15:87584854-87584876 AGGCCAGTAATTGGTTTTGCTGG + Intergenic
1143044529 17:4066370-4066392 AGGTGAGTAATTGGTTTTCCAGG + Intronic
1148250121 17:46070454-46070476 AGGAGGGTATTTGGTTTTATGGG - Intronic
1158184640 18:54757745-54757767 AGGACAATAATAGGTTTTATGGG + Intronic
1166094093 19:40529044-40529066 GGGCCCGTAACTGGTTTTCTTGG - Exonic
925695212 2:6569385-6569407 ATTTCTGTAATTGGTTTTCTTGG + Intergenic
926160516 2:10485697-10485719 AGGTCTCAAAATGGTTTTATAGG + Intergenic
929347493 2:40904209-40904231 AAGTCTTTTATTGGTTTTATTGG + Intergenic
933484192 2:82897112-82897134 AGTTCTGTAATTGTTTTTAGAGG + Intergenic
936603987 2:113929555-113929577 AGGTACCTGATTGGTTTTTTAGG + Intronic
941076588 2:161012071-161012093 AGATCCGCTATTAGTTTTATGGG - Intergenic
942951501 2:181727581-181727603 AAGTCCTTAATTGGTGATATGGG + Intergenic
1175642224 20:60640358-60640380 ATGTCCATAAATAGTTTTATTGG - Intergenic
1178072537 21:28984960-28984982 ATGTCTGTGATTGTTTTTATGGG - Intronic
1179530415 21:42014695-42014717 AAGTCCGAAATTGGTCTTATGGG + Intergenic
1183240891 22:36657525-36657547 GGGGCCGGAATTGCTTTTATTGG + Intronic
951179341 3:19640761-19640783 AGGTCTGTAATCTGTGTTATTGG + Intergenic
951224177 3:20101499-20101521 AGGTCTGTAACAGGCTTTATGGG - Intronic
955699380 3:61668643-61668665 AAGGCTTTAATTGGTTTTATGGG + Intronic
957273285 3:78058749-78058771 AGGTGTTTAATTGGTTTAATGGG + Intergenic
958173872 3:89970789-89970811 AGGTACCAAATTGGTTTCATTGG - Intergenic
963400651 3:144792955-144792977 AGGTATCTAACTGGTTTTATTGG + Intergenic
969140408 4:5066243-5066265 AGGTGCTTAATTGGATTTGTGGG - Intronic
970181627 4:13403192-13403214 ATGTCCATAAATAGTTTTATAGG - Intronic
979494930 4:121372273-121372295 AGGTGCGTGATTAGTTCTATGGG + Intronic
1014857470 6:126419639-126419661 AAGTCCGAAATTGGTTTCACTGG + Intergenic
1015414733 6:132935482-132935504 AGGTCTGTATTTCCTTTTATTGG + Intergenic
1020106380 7:5424026-5424048 AGGTCCGTAATTGGTTTTATAGG - Intronic
1020803597 7:12761369-12761391 AGGACTGTCATGGGTTTTATGGG + Intergenic
1031188878 7:118520476-118520498 ATGTCTGTTATTGGTTCTATCGG - Intergenic
1031574268 7:123396974-123396996 AGGTCAGTAATTGATTCAATGGG + Intergenic
1032814331 7:135456177-135456199 ATGTCCGTAGATAGTTTTATTGG - Intronic
1035151520 7:156877441-156877463 TGGTCTGTAGTTTGTTTTATTGG - Intronic
1038834937 8:31108987-31109009 AGGGCAGTAATTGGTTCTTTGGG + Intronic
1039713604 8:40084922-40084944 AAGTCCCTAATTCCTTTTATTGG - Intergenic
1046635870 8:116675218-116675240 ATGTCTGAAATAGGTTTTATTGG - Intronic
1051242779 9:15077627-15077649 AGGTCCCAAATTAGTTTTATAGG + Intergenic
1062170139 9:135130280-135130302 TGGTCCGACATTGGTTTGATTGG + Intergenic
1192103330 X:68288857-68288879 AGATCCGTAAGAGGCTTTATAGG - Intronic
1196106163 X:111897919-111897941 AGGTGCATGATTAGTTTTATAGG + Intronic
1199373625 X:147082097-147082119 AGATCTGTAATTGCTTTTTTGGG + Intergenic
1200275189 X:154725366-154725388 AGTTTTCTAATTGGTTTTATGGG - Intronic