ID: 1020106384

View in Genome Browser
Species Human (GRCh38)
Location 7:5424035-5424057
Sequence GGAGCCCCTAGGTCCGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106384_1020106391 5 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106391 7:5424063-5424085 TTTCCAGGCTCCCCTCGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1020106384_1020106396 23 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106396 7:5424081-5424103 CGGGGCTGAATGATCAAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 76
1020106384_1020106397 26 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106397 7:5424084-5424106 GGCTGAATGATCAAAACTGGTGG No data
1020106384_1020106389 3 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106389 7:5424061-5424083 AGTTTCCAGGCTCCCCTCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 144
1020106384_1020106386 -10 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106384_1020106390 4 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106390 7:5424062-5424084 GTTTCCAGGCTCCCCTCGGCGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1020106384_1020106388 0 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106388 7:5424058-5424080 AGCAGTTTCCAGGCTCCCCTCGG 0: 1
1: 0
2: 2
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106384 Original CRISPR GGAGCCCCTAGGTCCGTAAT TGG (reversed) Intronic
900944000 1:5819411-5819433 GGAGCCCCTGGGCCTGAAATAGG + Intergenic
921260906 1:213384423-213384445 GGAGCCTCCAGGTCTGTGATGGG + Intergenic
1075001463 10:118801822-118801844 GGAGCTCCTAGGTCAGGAAATGG + Intergenic
1083948706 11:65941678-65941700 AGATCCCCTAAGTCCCTAATAGG - Intergenic
1098296285 12:69007399-69007421 TGAGCCCCTTGGTTCATAATGGG - Intergenic
1106312522 13:28566384-28566406 GGAGCCCCTAGGTGGGTTAATGG + Intergenic
1111196775 13:84885346-84885368 GTAGCCCCTAGGTCTGTACTAGG - Intergenic
1121658360 14:95615394-95615416 GGAGATCCTATGTCTGTAATGGG - Intergenic
1122319588 14:100845688-100845710 GGAGCCCCCAGGTCTGCACTTGG - Intergenic
1123469717 15:20541160-20541182 GGAGCTCCTTGCTCCTTAATTGG - Intronic
1123648346 15:22459539-22459561 GGAGCTCCTTGCTCCTTAATTGG + Intronic
1123729995 15:23136146-23136168 GGAGCTCCTTGCTCCTTAATTGG - Intronic
1123748165 15:23333628-23333650 GGAGCTCCTTGCTCCTTAATTGG - Intergenic
1124280529 15:28357480-28357502 GGAGCTCCTTGCTCCTTAATTGG - Intergenic
1124302169 15:28554132-28554154 GGAGCTCCTTGCTCCTTAATTGG + Intergenic
1127745338 15:61964458-61964480 GAAGCCCTTAGGTAGGTAATAGG - Intronic
1133276510 16:4641271-4641293 GGAGACCCTAGGTCCCTGATGGG - Intronic
1161780296 19:6287236-6287258 GGAGCTCCTAGGTCCCTGAAGGG - Intergenic
1166857716 19:45791608-45791630 GGAGCCCCTAGGTAATAAATGGG - Intronic
1167293074 19:48635167-48635189 GGAGCCCCTAGGTCCTTTACAGG - Intronic
934159137 2:89231370-89231392 GGAGCCCCTAAGGCTGAAATGGG - Intergenic
934208135 2:89951055-89951077 GGAGCCCCTAAGGCTGAAATGGG + Intergenic
947712342 2:232323370-232323392 GGAGCCCCAGTGGCCGTAATGGG - Intronic
1172644716 20:36462163-36462185 GGAGCTCCTAGGTCCCAAGTTGG + Intronic
954242442 3:49304492-49304514 GGACCCCCTAAGTCAGGAATTGG - Intronic
962450172 3:135506944-135506966 TAAGCCCCCAGGTCCTTAATAGG + Intergenic
967364620 3:188671804-188671826 GGAGACTCTAGGCCCGGAATGGG + Intronic
998871677 5:146558647-146558669 AAAGCCACTAGGTCCATAATGGG - Intergenic
1002543640 5:179923738-179923760 GCAGCCCCCAGGACCGAAATAGG - Intronic
1020106384 7:5424035-5424057 GGAGCCCCTAGGTCCGTAATTGG - Intronic
1023106083 7:36764452-36764474 GGAACCACTGGGTCCGGAATTGG - Intergenic
1036289787 8:7477360-7477382 GGAGCCCTCAGTTCCCTAATGGG - Intergenic
1036331692 8:7834167-7834189 GGAGCCCTCAGTTCCCTAATGGG + Intergenic
1039211199 8:35216728-35216750 GAAGCCCCTAAGTCCTTCATTGG + Intergenic
1040295382 8:46146314-46146336 GAAGCCCCTAGGGCTGTCATGGG - Intergenic
1049020617 8:139955387-139955409 GGAGCCCCTGGGTCCGTCCAGGG - Intronic
1062285119 9:135769460-135769482 GGACCCCCTAGGTCCCTTCTCGG - Intronic