ID: 1020106386

View in Genome Browser
Species Human (GRCh38)
Location 7:5424048-5424070
Sequence TAGGGGCTCCAGCAGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106380_1020106386 -1 Left 1020106380 7:5424026-5424048 CCTATAAAACCAATTACGGACCT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106384_1020106386 -10 Left 1020106384 7:5424035-5424057 CCAATTACGGACCTAGGGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106378_1020106386 4 Left 1020106378 7:5424021-5424043 CCATTCCTATAAAACCAATTACG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106375_1020106386 17 Left 1020106375 7:5424008-5424030 CCTTGGCCCACAGCCATTCCTAT 0: 1
1: 0
2: 9
3: 27
4: 229
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106376_1020106386 11 Left 1020106376 7:5424014-5424036 CCCACAGCCATTCCTATAAAACC 0: 1
1: 0
2: 4
3: 7
4: 160
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data
1020106377_1020106386 10 Left 1020106377 7:5424015-5424037 CCACAGCCATTCCTATAAAACCA 0: 1
1: 0
2: 1
3: 12
4: 229
Right 1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106386 Original CRISPR TAGGGGCTCCAGCAGTTTCC AGG Intronic
No off target data available for this crispr