ID: 1020106594

View in Genome Browser
Species Human (GRCh38)
Location 7:5424973-5424995
Sequence CCTCCCTGGAGGGGGCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020106594_1020106606 17 Left 1020106594 7:5424973-5424995 CCGCCGCGCCCCCTCCAGGGAGG 0: 1
1: 0
2: 2
3: 38
4: 442
Right 1020106606 7:5425013-5425035 ATAAAATCTGTTGAGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020106594 Original CRISPR CCTCCCTGGAGGGGGCGCGG CGG (reversed) Intronic
900145916 1:1158608-1158630 CCTCCACGGAGGGGGCCCAGTGG - Intergenic
900168983 1:1257181-1257203 GGTGCCTGGAGGGGCCGCGGAGG - Intronic
900192415 1:1357046-1357068 CAGCCCTGGAGGGAGCGTGGGGG - Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900509736 1:3052887-3052909 CCTCCCTCGAGGTGGGGTGGGGG - Intergenic
900947161 1:5837411-5837433 CCTACCTGGGGGGAGCACGGGGG + Intergenic
901250303 1:7772599-7772621 CCTTCCTGGGCCGGGCGCGGTGG + Intronic
901443626 1:9293564-9293586 GCTCCCTGGGGGAGGCGCTGCGG - Intronic
901631679 1:10651139-10651161 CCTCCCTCCAGGGGGCACGGCGG - Intronic
901701555 1:11047162-11047184 CCTCCCTGCAGGGTGTGGGGTGG - Intronic
902330721 1:15730040-15730062 CCTACCTGGGCGGGGCGGGGCGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
903163013 1:21502846-21502868 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
904038002 1:27568964-27568986 CCTGCCAGGGTGGGGCGCGGGGG + Intronic
904093303 1:27959911-27959933 CCTCCCCGGACGGGGCGGGACGG + Exonic
904830618 1:33304229-33304251 CCTCCCTGCAGGGGTTGTGGTGG - Intergenic
905202582 1:36324037-36324059 CCTCCTAGGAGGGGGAGCGGTGG - Exonic
905713922 1:40131850-40131872 CCTCCCTGGCTGGAGTGCGGTGG + Intergenic
906141016 1:43533477-43533499 CCTCCCTGGGGGCGGGGAGGAGG + Intronic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
906846762 1:49200877-49200899 CCTCCCTGGAGGTTGGGGGGTGG + Intronic
907513688 1:54980447-54980469 CCGCCCTGGAGCGCTCGCGGGGG + Intergenic
908796258 1:67833461-67833483 CCTCGCTGGGGTGGGCGGGGCGG + Exonic
910193807 1:84620841-84620863 CTTCCCTGCAGAGGGCGCCGCGG - Intergenic
912557292 1:110525354-110525376 CCTCCCTGGAAAGGGTGTGGTGG + Intergenic
913972017 1:143423152-143423174 CCTCCCTGGAGAGGCAGCTGGGG + Intergenic
914066398 1:144248765-144248787 CCTCCCTGGAGAGGCAGCTGGGG + Intergenic
914112755 1:144717589-144717611 CCTCCCTGGAGAGGCAGCTGGGG - Intergenic
915261679 1:154681362-154681384 CCTCCATGGAGGGAGAGAGGTGG + Intergenic
918971657 1:191427724-191427746 CCTCCCTGGAGAGGATGCGTTGG - Intergenic
919536210 1:198790947-198790969 CCTCCCTGGAGGTTGGGAGGTGG + Intergenic
921512919 1:216054227-216054249 GTTCCCTGGAAGGGGCGTGGTGG - Intronic
922586448 1:226737690-226737712 GGACCCTGGAGGGCGCGCGGGGG + Intronic
923505446 1:234601410-234601432 CCTCCGGGGTGGGGGGGCGGTGG - Intergenic
923851407 1:237799963-237799985 CCTTCCTGGTTGGGGGGCGGGGG - Intronic
924482602 1:244451179-244451201 CCGCCCTGGGCGGGGCGGGGGGG + Intronic
1062877913 10:956715-956737 GCTCCCTGGAGGGTGGGCTGTGG + Intergenic
1064712525 10:18141142-18141164 TCTCCCGGGAAGGGGCGAGGAGG - Intronic
1065696919 10:28388544-28388566 CCTCCCCGGGCCGGGCGCGGTGG - Intergenic
1067026424 10:42847306-42847328 CCTCCCAGACGGGGTCGCGGTGG - Intergenic
1067110527 10:43396882-43396904 CCTCGCGGGAGGGGGAGGGGAGG + Intronic
1069549520 10:69353193-69353215 CCTCCCTGGAGGCGGCATGGGGG - Intronic
1071601556 10:86961030-86961052 CCTACCTGGGGGTGGGGCGGGGG + Intronic
1072290657 10:93961613-93961635 GAGCCCTGGAGGGGGCGGGGAGG - Intergenic
1072503839 10:96044284-96044306 CCCCCGGGGAGGGGGCGCAGAGG + Intronic
1072692919 10:97583558-97583580 CCTGCCTGGAGGGGGCGGGACGG - Exonic
1075608718 10:123834796-123834818 CCTCCTTGGTGGGGGTGCAGGGG + Intronic
1076025280 10:127107107-127107129 CATCCCTGGGGTGGGAGCGGTGG - Intronic
1076502156 10:130945684-130945706 CCTCCCTGGAGGGGTGGGGGTGG + Intergenic
1076657858 10:132036596-132036618 CCGCCCGGGAGTGGGGGCGGCGG + Intergenic
1076915137 10:133419654-133419676 CATCCCTGGAGGAGGCAGGGAGG + Intronic
1077037010 11:500115-500137 CTTCCCTGGACGGGGCTCTGGGG + Intronic
1077043167 11:533389-533411 GCTCCCTGGCTGGGGCGGGGCGG + Intronic
1077078097 11:710232-710254 CTTCCCTGGAGGGAGGGAGGGGG + Intronic
1077090368 11:775661-775683 CTTCCCTGGAAGGGGTGAGGGGG - Intronic
1077138077 11:1011466-1011488 CGTCCCTGGAGGGGCTGTGGAGG + Exonic
1077158017 11:1100008-1100030 CTTACCTGGAGGGGACGTGGTGG - Intergenic
1077307839 11:1875882-1875904 CCTCCCTGGAGAGGCAGCTGGGG - Intronic
1077391032 11:2300724-2300746 CCTCCCTGGAGCTGGTGAGGCGG - Exonic
1077613019 11:3656219-3656241 CTTCCCTGGGCCGGGCGCGGTGG - Intronic
1078390398 11:10931485-10931507 CCTCCCTGGGGAGTGTGCGGAGG + Intergenic
1080418651 11:32091649-32091671 CCACCCCGGCCGGGGCGCGGCGG - Intronic
1082076492 11:47980043-47980065 CCTCCCTGGCCGGCGCTCGGGGG + Intergenic
1083277098 11:61603068-61603090 GCTCCCTAGAGGGGGTGCAGGGG - Intergenic
1083308369 11:61772302-61772324 CCTCCCTAGAGGGAGGGAGGAGG + Intronic
1083691732 11:64413377-64413399 CCATCCTGGAGGGTGGGCGGTGG + Intergenic
1083747316 11:64743426-64743448 GCTCCCGGGAGGGGGCGAGGCGG - Intronic
1083942039 11:65901036-65901058 CTTACTTGGAGGGGGCGCTGAGG - Intergenic
1084677026 11:70641511-70641533 CCTCCCTGCAGGGGAGGCTGGGG - Intronic
1085450355 11:76628569-76628591 CCTCCCTGTTGGGGGCACAGTGG + Intergenic
1088288726 11:108212985-108213007 CCTCCCTGGGCGGGGCATGGTGG + Intronic
1089261470 11:117226754-117226776 CCTCCCTGGAGGTGGTTCTGTGG - Intronic
1089598091 11:119594869-119594891 CCTCCCTGGAGGGTGGGAGGGGG + Intergenic
1090028225 11:123185560-123185582 CCTCCCTGGGGATGGAGCGGAGG + Intronic
1090387879 11:126367047-126367069 CCTGCCTGTAGGGGGCACCGTGG + Intronic
1090509601 11:127360771-127360793 CCTCTCTGGGCCGGGCGCGGTGG - Intergenic
1092104744 12:5913383-5913405 CCTCCCTGGAGGCTGCTCTGTGG - Intronic
1093925071 12:24902082-24902104 CCACCCTGCCGGGGTCGCGGCGG + Intronic
1094814085 12:34166768-34166790 GCTCCCTGCTGGGGACGCGGTGG - Intergenic
1096049257 12:48592798-48592820 CCTCCCTGGAGGTTGGGGGGTGG - Intergenic
1096113888 12:49043963-49043985 CCTGCCTGCAGAGGGCGCCGTGG - Exonic
1096525606 12:52208238-52208260 CCTCCCTGCAAGGGGCCAGGAGG - Intergenic
1096647640 12:53047338-53047360 CCGGCCGGGCGGGGGCGCGGCGG - Intronic
1097198009 12:57254967-57254989 GCTGCCTGGAGGGGGTGGGGGGG - Exonic
1100048210 12:90411138-90411160 CCTCCCAGGCGGGGTGGCGGCGG - Intergenic
1100416689 12:94385212-94385234 CCTCCCTGGATGGGAAGCGTAGG + Intronic
1101556975 12:105819167-105819189 CCTGCATGGAAGGGGCGTGGGGG + Intergenic
1101781551 12:107843333-107843355 ACGCCTTGGAGGGGGCGCTGGGG - Intergenic
1101789221 12:107912495-107912517 GCCCCCTGCAGGGGGCGCTGTGG + Intergenic
1102459658 12:113092875-113092897 CCTCCCTCGAGAGGGCGCTTTGG - Intronic
1102513182 12:113429238-113429260 CCTCCCTGCAGGTGGTGCAGAGG + Exonic
1103303018 12:119942560-119942582 CCTCCCTTGAGGGGGCATGTGGG - Intergenic
1103509964 12:121467372-121467394 CCGCGCTGGAGGGGGCGGGGAGG + Intronic
1103929240 12:124440418-124440440 CCACCCTGGCCGGGGGGCGGCGG - Intronic
1104207041 12:126649222-126649244 GCTCCCTGGGCTGGGCGCGGTGG + Intergenic
1104785946 12:131447933-131447955 TCTCCATGGAGACGGCGCGGGGG + Intergenic
1105992087 13:25632325-25632347 CCTCCCTGGAGGTTGAGGGGTGG + Intronic
1106104371 13:26721454-26721476 GCTCCCTGGATGGGGCTCGGGGG + Intergenic
1108292595 13:48976239-48976261 CCGCCCCGGAGGAGGCGCCGCGG + Intronic
1112330883 13:98476243-98476265 CCACTCTGCAGGGGGCGGGGGGG - Intronic
1112534223 13:100234693-100234715 CCTCCGAGAAGGGGGCGGGGGGG - Intronic
1113695621 13:112343321-112343343 AGTCCCCGGAGGGCGCGCGGTGG - Intergenic
1113768387 13:112894446-112894468 GGGGCCTGGAGGGGGCGCGGGGG + Intronic
1113994094 14:16052871-16052893 CCTCTCTGGCGGGTGCGCGCGGG + Intergenic
1114062094 14:19027093-19027115 TCTCCCTGCGGGCGGCGCGGTGG - Intergenic
1114100162 14:19372904-19372926 TCTCCCTGCAGGCGGCGCGGTGG + Intergenic
1117545884 14:56794671-56794693 CCGCCCTGGAGGGGACCCGGCGG + Intergenic
1117558518 14:56911231-56911253 CCTCCATGGGTGGGGGGCGGGGG - Intergenic
1117753464 14:58947960-58947982 CGGCACTGGAGGGGGCGCTGTGG - Intergenic
1118005600 14:61562157-61562179 CCTCCCTGGAGAGGAGGTGGGGG - Intronic
1118410824 14:65475853-65475875 CCTCCTTGTAGGGGGTGAGGTGG + Intronic
1118438639 14:65793142-65793164 CCTCCCTTGGCCGGGCGCGGTGG - Intergenic
1118563965 14:67118749-67118771 CATCCCTCCAGGGGTCGCGGGGG + Intronic
1119374724 14:74180543-74180565 CCTCCCTAGGCTGGGCGCGGTGG - Intronic
1119378971 14:74216833-74216855 CCTCCCTGGGCCGGGTGCGGTGG + Intergenic
1119786822 14:77320617-77320639 CGTCCCCGGAGGGGCCGCTGTGG - Exonic
1120568920 14:86093654-86093676 CCTCCCTCGGCCGGGCGCGGTGG + Intergenic
1120957553 14:90096229-90096251 CCTCCCTGGAGGTTGCGGTGTGG + Intronic
1121089906 14:91174032-91174054 CCTCCCTGGAGGTTGCGGGGAGG - Intronic
1122488641 14:102098056-102098078 TCTCCCTGGAGGTGGCAGGGAGG - Intronic
1122700033 14:103582097-103582119 CTTCCCATGAGGAGGCGCGGAGG - Intronic
1122836498 14:104433405-104433427 CCTCTCTAGAGGGGCCGGGGTGG - Intergenic
1122939211 14:104973746-104973768 CCTTCCTGCAGGGGTGGCGGTGG - Intronic
1123494718 15:20814374-20814396 TCTCCCTGCGGGCGGCGCGGTGG + Intergenic
1123551213 15:21383467-21383489 TCTCCCTGCGGGCGGCGCGGTGG + Intergenic
1125450411 15:39801435-39801457 CCTGCCTGGAGGGAGAGCAGGGG - Exonic
1125599205 15:40906469-40906491 CCGCCCTGGAGAGGGCCCTGGGG + Intergenic
1128455285 15:67828310-67828332 CCTCACTGGAGGGTGCGGGTGGG - Intronic
1129940847 15:79495421-79495443 GCTCCCTGGAGGGAGCGGGGTGG + Intergenic
1131105288 15:89729665-89729687 CATTCCTGGTGGGGGGGCGGGGG - Exonic
1131150089 15:90042348-90042370 GCTGCCTGGAGGGGGTGGGGGGG - Intronic
1131426052 15:92346350-92346372 CCTCCCTGGAGGTTGAGGGGTGG - Intergenic
1202959555 15_KI270727v1_random:110710-110732 TCTCCCTGCGGGCGGCGCGGTGG + Intergenic
1132523045 16:400239-400261 ACTCCGTGGAGGGGGCCCAGCGG + Exonic
1132598862 16:765099-765121 CCTCTCTGCAGGGTGTGCGGGGG + Exonic
1132623411 16:878980-879002 CCCCCCTGGAGGCAGCGTGGGGG + Intronic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1132654799 16:1037310-1037332 CTTCCTTGGAGCGGGCGAGGAGG - Intergenic
1132670486 16:1100480-1100502 CCAGCCTGGAGGGGACGGGGAGG - Intergenic
1132885715 16:2181144-2181166 CCTCCCTGGGCGGGGTGCCGGGG + Exonic
1132935012 16:2475608-2475630 CATCCCTGGGCGGGGCGGGGCGG - Intronic
1133041113 16:3060069-3060091 CCTCCCAGGAGGGAGTGCTGAGG - Exonic
1134071803 16:11264922-11264944 CCTGCCTGGAGGGGTCCCAGTGG - Intronic
1134327070 16:13216982-13217004 CCACCCTGGGCTGGGCGCGGTGG + Intronic
1136233929 16:28903280-28903302 CCTCTCAGGAGGGGGTGGGGAGG - Intronic
1136630582 16:31487412-31487434 CCTACCAGGGAGGGGCGCGGAGG + Intronic
1136691883 16:32038873-32038895 CCTCCCTGCAGGGGGACAGGAGG + Intergenic
1136792471 16:32982435-32982457 CCTCCCTGCAGGGGGACAGGAGG + Intergenic
1136877346 16:33871472-33871494 CCTCCCTGCAGGGGGACAGGAGG - Intergenic
1136933368 16:34437358-34437380 CCTCCCGGGAAGGAGCTCGGAGG + Intergenic
1136971204 16:34974456-34974478 CCTCCCGGGAAGGAGCTCGGAGG - Intergenic
1138420066 16:56893081-56893103 CCTGCCCGGCGGGGGCGGGGTGG + Intronic
1138478140 16:57284110-57284132 CCACCTTGGAGGGGGCACGATGG + Intronic
1140602923 16:76500077-76500099 CCTCCCTGACGGGGTGGCGGCGG + Intronic
1142261465 16:89044400-89044422 CCGCCCTGGAGTGGACGCAGCGG + Intergenic
1142374478 16:89700182-89700204 CCTCCCAGGGGGCGGGGCGGGGG - Intronic
1203094677 16_KI270728v1_random:1243900-1243922 CCTCCCTGCAGGGGGACAGGAGG + Intergenic
1142610821 17:1108629-1108651 CCTCCCTGGAGCGGGTGGGCAGG - Intronic
1142743117 17:1942064-1942086 CCACCCAGGAGGGGACGAGGAGG - Intronic
1143014838 17:3886209-3886231 GCTCCCTGGAGGAGGCGGGTGGG - Intronic
1143015122 17:3887577-3887599 CCTCCCTGGAGGAGGTGAGAGGG + Intronic
1143015164 17:3887721-3887743 CCTCCCTGGAGGAGGTGAGAGGG + Intronic
1144721920 17:17476957-17476979 CGCCCCTGCAGGGCGCGCGGTGG + Intergenic
1144756484 17:17682840-17682862 CCGGGCTGGCGGGGGCGCGGCGG + Intronic
1144783034 17:17817329-17817351 CCTCCTTGCTGGGGGCCCGGGGG - Exonic
1146763292 17:35496580-35496602 TCTCCCTGGAAGGAGCGGGGCGG + Intronic
1147612810 17:41811724-41811746 GCTACCTGGAGGCGGCGCTGCGG - Exonic
1147717948 17:42520678-42520700 CCTGCCAGGAGGGGGCGATGGGG + Intronic
1147904517 17:43814135-43814157 CCTCCCTGGAGCAGGTGGGGAGG - Intronic
1148334334 17:46831685-46831707 CTTCACTGGAGGGGACCCGGAGG - Intronic
1148800448 17:50221705-50221727 CCTCCCTCGAGTGAGCGGGGAGG - Intergenic
1148806634 17:50267177-50267199 CCTGCCTGGAGGGTGGGAGGGGG - Intergenic
1148878281 17:50705944-50705966 CCTACCTGGACCTGGCGCGGTGG - Intronic
1149557490 17:57584473-57584495 CCCCCCTGTGGGGGGCGCGGAGG + Intronic
1151537471 17:74747051-74747073 CCGGCCTGGAGGGGGAGAGGGGG + Exonic
1151567475 17:74907295-74907317 CCTCACTGCCGGGGGCCCGGCGG + Intergenic
1151732164 17:75917959-75917981 CCTCCCAGGAGCGGGAGCTGGGG - Exonic
1151947317 17:77326773-77326795 CCTACCTGGAGGTTGCGGGGTGG - Intronic
1151970606 17:77455625-77455647 CCCCCTTGGAGGGGGCGTGCAGG - Intronic
1152234761 17:79132888-79132910 CCACCCTGGACGGGGCGTGCGGG + Intronic
1152461770 17:80445551-80445573 CCTCCCCGCCGGGAGCGCGGGGG + Intergenic
1152526363 17:80890320-80890342 CTTCCCTGGAAGGGGCCCAGTGG + Intronic
1152567706 17:81107540-81107562 CCTCCCTGGACGGAGCGGGCTGG - Intronic
1152617865 17:81346099-81346121 CTTCCCTCGTGGGGGCGGGGCGG - Intergenic
1152713705 17:81888060-81888082 GCTCCCTGGTTGGGGGGCGGTGG - Exonic
1152741380 17:82019948-82019970 CCACCCTGGGGGGTGCGGGGGGG - Intronic
1152744916 17:82034107-82034129 CTTCCCTGGAGGGGGAGGGTGGG + Exonic
1152925396 17:83085332-83085354 CCTGCCTGGGGCGGGGGCGGCGG + Intronic
1153610583 18:6880362-6880384 CCTCCCTGGAAGTGGTGCTGTGG + Intronic
1154319122 18:13330799-13330821 CCTCCCTGGAGGGTGGGGGTGGG - Intronic
1156498376 18:37540924-37540946 CCTGCCTGGAGGTGGAGTGGGGG + Intronic
1156503406 18:37574266-37574288 CCTCCCTGGCGGGGAGGTGGGGG - Intergenic
1157688344 18:49661050-49661072 CCTCCCTGGAGGTCGGGGGGTGG - Intergenic
1157689785 18:49671917-49671939 CCTCCTTGGGGCGGGGGCGGGGG + Intergenic
1158137515 18:54223992-54224014 CCTCCCTGGGGGCGGGGAGGGGG - Intronic
1160233491 18:77067208-77067230 CCTCCCAGAAGGGGGCGGGGGGG - Intronic
1160539305 18:79611681-79611703 CCTCCCTGGATGGGCCGAAGGGG + Intergenic
1160803176 19:979824-979846 CCTCCCTGGCTGGGGAGAGGTGG - Intergenic
1160908176 19:1461563-1461585 CCTCACTGGGCCGGGCGCGGTGG + Intronic
1161073402 19:2273554-2273576 CCTGGGTGGAGGGGTCGCGGGGG + Intronic
1161103100 19:2431025-2431047 CCTCCCTGGTGGGGAGGTGGGGG - Intronic
1161153382 19:2720911-2720933 ACCCCGGGGAGGGGGCGCGGAGG + Intronic
1161199544 19:3006712-3006734 CCTCCCAGGTGCGGGTGCGGGGG - Intronic
1161395708 19:4043848-4043870 CCTTCCTGGAGGTGGGGGGGGGG - Intergenic
1162144440 19:8605247-8605269 CCTCCCCGGAGGCAGCGCCGCGG - Exonic
1162385441 19:10358003-10358025 CCTCCCTGGAGAGGGCGCCCAGG + Exonic
1162554535 19:11378535-11378557 CCTCCGTGAAGGGGGTGCAGGGG + Exonic
1162788656 19:13051842-13051864 GGTGCCTGGAGGGGGCGGGGCGG + Intronic
1162808688 19:13151794-13151816 CTTCCGGGGGGGGGGCGCGGAGG - Intronic
1162810727 19:13163167-13163189 CCTCCCTGGGGCGGGCAGGGCGG - Intergenic
1163484363 19:17577283-17577305 CTTCCCTGGAGGCGGGGCGGGGG + Intronic
1163580771 19:18137373-18137395 TCCCCCTGGAGGGGGGGCGGGGG + Intronic
1163779396 19:19238436-19238458 CCTGCCTGGAGGGTGGGCAGGGG + Intronic
1164527544 19:29022912-29022934 CCAGCCTGGAGGGGGGCCGGAGG + Intergenic
1165325452 19:35111818-35111840 CCTCCGTGGATGGGGGGTGGCGG + Intergenic
1166066010 19:40359400-40359422 CCAACCTGGATGGGGCGCGCTGG + Intronic
1166106686 19:40601240-40601262 CCTCCCCGGCGGCCGCGCGGGGG - Intronic
1166838386 19:45681582-45681604 CCTGCCCAGAGGAGGCGCGGAGG - Exonic
1166985970 19:46660298-46660320 GATCTCTGGAGGGGGCGGGGTGG - Intronic
1167162641 19:47778289-47778311 CTCCCCTGGAGAGGGCGAGGGGG - Intergenic
1167181494 19:47907543-47907565 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167182152 19:47912916-47912938 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167182810 19:47918294-47918316 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167183479 19:47923644-47923666 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167184118 19:47928683-47928705 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167184775 19:47934046-47934068 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167186100 19:47944787-47944809 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167186758 19:47950161-47950183 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167187410 19:47955547-47955569 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
1167247651 19:48383358-48383380 CCTCCCTGCAGGGGCCCCAGCGG - Intronic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1167361296 19:49031900-49031922 CCTCCCTCCAGGGGGCGCCACGG - Intronic
1167362356 19:49036885-49036907 CCTCCCTCCAGGGGGCGCCACGG + Exonic
1167541500 19:50090923-50090945 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167541773 19:50092722-50092744 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167542446 19:50098059-50098081 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167542883 19:50101124-50101146 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167543319 19:50104188-50104210 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167543753 19:50107247-50107269 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167544427 19:50112601-50112623 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167545102 19:50117953-50117975 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167545779 19:50123307-50123329 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167546456 19:50128635-50128657 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167547125 19:50133977-50133999 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167547784 19:50139350-50139372 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
1167627933 19:50604828-50604850 CCTCCCTCCAGGGGGCGCCATGG + Intergenic
925224468 2:2171063-2171085 CCTGGCTGGAGGGGTCCCGGCGG + Intronic
925750777 2:7089356-7089378 CATCCCTGGAGAGGGCGCCTCGG - Intergenic
926358738 2:12065402-12065424 CCTCCCTGGAGAAGGCAGGGAGG + Intergenic
926584886 2:14675068-14675090 CTTCCCTGGAGCAGGGGCGGGGG - Intergenic
929107281 2:38377320-38377342 CCTCCCGGGAGCCGGCGGGGTGG + Intergenic
929983066 2:46699148-46699170 CCTCCCGGGGCGGGGGGCGGGGG - Intronic
930363583 2:50411594-50411616 CCTCCCAGAAGGGGTGGCGGTGG - Intronic
932635724 2:73386179-73386201 CCTCCCTGGAGAAGGTGAGGCGG + Exonic
932812320 2:74835208-74835230 GTTCCGGGGAGGGGGCGCGGCGG - Intronic
933078199 2:77955139-77955161 CCTCCCTCCAGGGGGCGCCATGG - Intergenic
934176716 2:89584089-89584111 CCTCCCTGGAGAGGCAGCTGGGG + Intergenic
934287022 2:91658449-91658471 CCTCCCTGGAGAGGCAGCTGGGG + Intergenic
934554208 2:95278827-95278849 CCTCCCTGGTAGGGGTGGGGTGG - Intronic
936093488 2:109515365-109515387 CCTCCCTGGAGGGTCCGTGGGGG + Intergenic
936146021 2:109981130-109981152 CCTCCCTGGATGTGGTGAGGAGG - Intergenic
936198668 2:110390348-110390370 CCTCCCTGGATGTGGTGAGGAGG + Intergenic
936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG + Intergenic
937183187 2:120013715-120013737 CGTCCCGGGTGGGGGCGGGGCGG - Intronic
937307393 2:120880917-120880939 GCTCCCTGGTGGGGGCAGGGGGG - Intronic
938595543 2:132784006-132784028 CCTGCCTGGAGGGGGCGGAGGGG + Exonic
939203057 2:139063066-139063088 CCTTCCTGGAGGTGGGGGGGGGG + Intergenic
941427539 2:165367791-165367813 CCTCACAGGAGGGGGAGCGCAGG + Intronic
942653815 2:178194657-178194679 CCTACCTGGAGGGCGAGCGGTGG - Exonic
943411697 2:187556584-187556606 CCTCCCAGACGGGGTCGCGGCGG - Intronic
943692447 2:190881705-190881727 TCGCCCTGGTGGGGCCGCGGTGG + Intronic
943731565 2:191308029-191308051 CCTCCCTGGAGGTGGGGAGGTGG + Intronic
944242608 2:197500285-197500307 CCTCCCTGGGAGGGGCGAGGGGG + Exonic
944748451 2:202682450-202682472 CCTCGCAGGAGGGGGAGCGCAGG - Intronic
946332825 2:219019764-219019786 CTTCCCTGGAGGGGGCATGCAGG + Intronic
947637484 2:231687501-231687523 CCTCCCGGGAGTTGGCGGGGTGG - Intergenic
947736780 2:232459308-232459330 GCTCCCTGAAGGGGATGCGGAGG - Exonic
947765576 2:232635012-232635034 CCTCCATGCAGGGGCAGCGGAGG - Intronic
948040878 2:234900662-234900684 CCTCCCTGGAGGGTGGGGAGTGG - Intergenic
948061417 2:235045457-235045479 CCTCCCTGGAGCGGACAGGGAGG - Intronic
948449580 2:238060885-238060907 CCTCCCCGCTGGGGGCTCGGCGG + Exonic
948645222 2:239400434-239400456 CCGCCGGGGCGGGGGCGCGGGGG - Exonic
948679982 2:239627140-239627162 CCTCCCGGGAAGGGGTGCCGGGG + Intergenic
949023232 2:241752927-241752949 CCGCCCTGGGGGTGGCGTGGGGG - Intronic
1168944291 20:1738736-1738758 CCTCCCTGCAGAGGGTGGGGGGG + Intergenic
1169140589 20:3225381-3225403 CCTCCCTGGAGGTGTGGCGGGGG - Intergenic
1170165040 20:13352947-13352969 CTTCCCTGGAGCGGGCAAGGTGG + Intergenic
1171235415 20:23520446-23520468 CCTCCCTGGAGGTGGAGGGTGGG + Intergenic
1171368407 20:24643589-24643611 CCTCACTGAAGGGGGTGAGGAGG - Intronic
1172063844 20:32206256-32206278 CCACTCTGGAGTGGGCGGGGGGG - Intronic
1172183492 20:33017578-33017600 CCTCCCTGAAGGCTGCTCGGAGG + Intronic
1172656395 20:36541212-36541234 CCTCTCTGGAGGGGAAGGGGTGG + Intergenic
1173201760 20:40959953-40959975 CCTCCCTGCAGGAGGAGGGGAGG + Intergenic
1173279714 20:41617932-41617954 CCCCCCCGGGGCGGGCGCGGTGG - Intronic
1173494308 20:43507797-43507819 CCGCCCTGGACGGAGCGGGGTGG - Intronic
1174364620 20:50048958-50048980 CGCCTCTGGAGGGGGCGGGGAGG - Intergenic
1174371199 20:50089309-50089331 CCTCCAAGGAGGGGGCTTGGCGG + Intronic
1174705634 20:52653049-52653071 CCTCCCTGGAGGGGGAGGTTGGG + Intergenic
1174898587 20:54475645-54475667 CCTGCCAGGAGGAGGAGCGGCGG - Exonic
1175160114 20:57002167-57002189 CCTCCCTGGTGGGTGTGGGGTGG - Intergenic
1175793513 20:61757238-61757260 GCCCCCTGGAGGGGGCTGGGGGG - Intronic
1175889960 20:62311677-62311699 CCTCCCAGGAGGAGCCTCGGGGG + Exonic
1175939474 20:62531393-62531415 CCTCCCAGGAAGGGGGGTGGCGG - Intergenic
1176019343 20:62954575-62954597 CCATCCTGCTGGGGGCGCGGGGG - Intronic
1176128242 20:63485446-63485468 CCCACCTGGAGGGGGCCCTGTGG + Intergenic
1176246990 20:64102176-64102198 CCTCCCTCCAGGGGGCGCTGTGG + Intergenic
1176286071 21:5020343-5020365 CCTCTCTCGGGGGGGCGGGGGGG + Intergenic
1176549383 21:8214708-8214730 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1176557276 21:8258931-8258953 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1176568311 21:8397742-8397764 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1176576218 21:8441966-8441988 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1179502693 21:41820041-41820063 CCTCGCTGGAGGGGGCTGGCAGG - Intronic
1179519368 21:41932067-41932089 CCTCCCTGGAGGTGGAGTGGTGG - Intronic
1179723645 21:43329987-43330009 GCACCCTGGAGGGGGTGAGGGGG - Intergenic
1179871110 21:44243132-44243154 CCTCTCTCGGGGGGGCGGGGGGG - Intergenic
1179995254 21:44971201-44971223 CCTGCCTGGAGGGAGTGCCGTGG + Intronic
1180046620 21:45309199-45309221 CCTCCCTCCAGGGGGCGCCAGGG - Intergenic
1180090815 21:45533113-45533135 CCTCCCAGGAGGGGGAGCACAGG + Intronic
1180144885 21:45913502-45913524 CATCCCAGGAGGGGCCCCGGTGG + Intronic
1180313174 22:11254644-11254666 CCTCTCTGGCGGGTGCGCGCGGG - Intergenic
1180480584 22:15749707-15749729 TCTCCCTGCGGGCGGCGCGGTGG - Intergenic
1180707243 22:17817359-17817381 CCCCGCTGGAGGGGGTGCTGGGG + Exonic
1180749243 22:18112984-18113006 CCTCCCTGGTGGGGGTTTGGGGG + Intronic
1180757229 22:18170479-18170501 GCTCCCTGGAGCAGACGCGGTGG + Intronic
1180869566 22:19138541-19138563 CCTCCCTGGATGGGAGGAGGGGG - Intronic
1181512668 22:23395829-23395851 CCTCCGTGGAGTGGGCTGGGTGG - Intergenic
1181750806 22:24987986-24988008 CCTGCCTGGGCGGGGCACGGTGG + Intronic
1181831662 22:25564947-25564969 CCCCCCAGGTCGGGGCGCGGCGG + Exonic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1182294900 22:29306973-29306995 CCTGCCCGGAGGGGGCGGGCGGG - Intronic
1183580886 22:38726084-38726106 CCTCCCTGTAGCTGGTGCGGGGG - Exonic
1184282957 22:43449426-43449448 CCTACTTGGAGGGGGGGCGGGGG - Intronic
1184404366 22:44291814-44291836 CCTCCGTGTGGGGGTCGCGGTGG - Intronic
1184523246 22:45007890-45007912 CCTCCCCGGAGGGGGCCCGGAGG + Intronic
1184555640 22:45231532-45231554 CCTCCCTGGGGAGGGGGTGGTGG - Intronic
1184593806 22:45502684-45502706 CTTCCCCGGAGGGGGCACAGAGG - Intronic
1184620284 22:45671778-45671800 CCTGAGGGGAGGGGGCGCGGCGG - Exonic
1184707531 22:46224738-46224760 CCTCCCTGCAGGGGCTGCTGGGG + Intronic
1185031607 22:48446408-48446430 CATCCCTGGAGGGGGTTGGGGGG - Intergenic
1185132633 22:49048062-49048084 GCTCCCTGGAGGGGCTGTGGTGG - Intergenic
1185335857 22:50270545-50270567 CCTTCCCGGGGGGGGCGCCGAGG + Intronic
1203254268 22_KI270733v1_random:131024-131046 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1203262324 22_KI270733v1_random:176103-176125 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
950997529 3:17518901-17518923 CCTCACGGGAGGGAGCGCGCAGG - Intronic
953924783 3:46977185-46977207 CTTCCCTGGGCCGGGCGCGGTGG + Intronic
953928952 3:46996509-46996531 CATCCCTGGAGGGTGAGCTGGGG + Exonic
954214146 3:49115183-49115205 CTTGGCTGGAGGGGGCGGGGAGG - Intronic
954781266 3:53063091-53063113 CCACCCTGGTGGAGGCGGGGCGG + Intronic
957074414 3:75590508-75590530 CCTCTCTGAAGGGGAGGCGGTGG - Intergenic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
962588141 3:136862493-136862515 CCGAGCCGGAGGGGGCGCGGAGG + Intronic
963870603 3:150410039-150410061 CCTCCATGCAGGGGGCGCACGGG + Exonic
964087554 3:152835638-152835660 CCCCGCGGGAGGGGGCGCGCAGG - Exonic
965558128 3:170038067-170038089 CCTCCCGGGAGCGCGCGGGGCGG + Exonic
965561100 3:170063009-170063031 CCTCCCAGGATGGAGTGCGGTGG - Intronic
967305024 3:188051681-188051703 GCTCCTTGGGGTGGGCGCGGTGG - Intergenic
967557821 3:190878163-190878185 CCTCCCTCCAGGGGGCGCCATGG - Intronic
967651924 3:191996268-191996290 CTTCCCTGGAGCGGGTGTGGGGG + Intergenic
967807303 3:193727384-193727406 CCACCCTGGAGGGAGAGCTGGGG - Intergenic
967859594 3:194141282-194141304 CCGCCCCGGCGGGCGCGCGGCGG - Intergenic
968414504 4:418497-418519 GCTACCTGGAGGGGGTGCTGAGG + Intergenic
968452371 4:681598-681620 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452380 4:681618-681640 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452389 4:681638-681660 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452398 4:681658-681680 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452407 4:681678-681700 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452416 4:681698-681720 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452425 4:681718-681740 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452434 4:681738-681760 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968662064 4:1802774-1802796 GCTGCCTGGAGGAGGCGTGGAGG - Intronic
968702981 4:2065418-2065440 CTGCCCTGGACGGGGGGCGGGGG + Exonic
969330598 4:6471899-6471921 CCTCCCGGAGGGCGGCGCGGAGG + Intronic
969876816 4:10141528-10141550 CCTCCCTGGGGGAGGGGTGGGGG + Intergenic
971363273 4:25955947-25955969 CCTCCCTGGAGGTTGAGGGGTGG - Intergenic
972437049 4:39044770-39044792 CCTGGCGGGAGGGGGCGGGGCGG + Intergenic
972568277 4:40287953-40287975 CCTCCCAGGGCGGGGCGCAGTGG - Intergenic
972691816 4:41406511-41406533 CCTCCCTGGAGAGGGAGGGAGGG - Intronic
976184236 4:82429523-82429545 CCGCCCGGCAGGGGGCGCGCCGG - Exonic
976256949 4:83109602-83109624 CCTCCCTGGAAGAGGCCCGAAGG - Intronic
978503469 4:109433558-109433580 CCGGCCTGCAGGGGGCGCTGCGG + Intergenic
979666524 4:123316936-123316958 CCTCTCTGGGCTGGGCGCGGTGG + Exonic
982575935 4:157110063-157110085 CCTCCCTGAAGGTTGCGGGGTGG + Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983884644 4:172966677-172966699 ACTCCCTGGGCTGGGCGCGGTGG - Intronic
984923407 4:184785591-184785613 CCTCCTGGGCGGGGGCGGGGGGG + Intronic
985467701 5:12986-13008 CGTCCCCGGCGGGGGCGGGGTGG + Intergenic
985716310 5:1463926-1463948 CCTCCCTGGAGGGCGTGAGGTGG - Intronic
985995458 5:3595016-3595038 CCCCCTTCGCGGGGGCGCGGGGG + Intergenic
986299719 5:6468314-6468336 CCTCCCTGGAGCTGGAGCAGGGG + Intronic
986330450 5:6713399-6713421 CCTCATTGGAGCGGACGCGGCGG + Intergenic
987193192 5:15500226-15500248 CTTCCCCGGGGAGGGCGCGGCGG - Exonic
987247063 5:16059811-16059833 CCTCCCTGAAGAGGGCGGAGGGG - Intergenic
990327729 5:54694683-54694705 GCTTCCTGGAGGGGGCTCTGAGG + Intergenic
991474367 5:67004141-67004163 GCTCCGGGGAGGGGGAGCGGCGG + Intronic
992563315 5:77973372-77973394 CCATCCTGGAGGGAGCGCGAGGG + Intergenic
997884137 5:137615527-137615549 CCTCTGGGGAGGGGGGGCGGGGG - Intergenic
998164778 5:139836772-139836794 CCTCCCTGGAGGTGGTGCTCAGG + Intronic
998296966 5:140980342-140980364 ACTTCCTGGACTGGGCGCGGTGG + Intronic
999191053 5:149747791-149747813 CCTCCCTGGTGGGGTGGGGGTGG + Intronic
1001490237 5:172149756-172149778 CCTCCTTGGGCCGGGCGCGGTGG + Intronic
1001691113 5:173633267-173633289 CCTCCGTGGAGGGGGGGCTCTGG - Intergenic
1002087950 5:176787525-176787547 TCTCCATGGTGGGGGCGGGGGGG + Intergenic
1002421252 5:179150196-179150218 CCTGCCTGGGGTGGGTGCGGCGG + Intronic
1003175517 6:3750675-3750697 CAGCCCTGGCGGGGGTGCGGGGG + Intronic
1003503890 6:6724631-6724653 CCTTCCTGGAGGGTCTGCGGAGG - Intergenic
1005581901 6:27243117-27243139 GCGCGCTGGATGGGGCGCGGGGG + Intergenic
1006304527 6:33211308-33211330 ACCCCGTGGAGGGGGCGCAGGGG + Exonic
1006592545 6:35169081-35169103 CCTCCCTGGAGGATGCCTGGTGG + Intergenic
1006634284 6:35451285-35451307 CCTCCCTGTGGAGGGCGGGGGGG - Intergenic
1006826928 6:36941949-36941971 CCTCCCAGAAGGGGTGGCGGCGG - Intergenic
1007790631 6:44306329-44306351 CCTCCCTGGAGCGGGGTAGGCGG - Exonic
1010142153 6:72623248-72623270 CCGCGCTGCAGGGGGCGGGGAGG + Intronic
1017150286 6:151273192-151273214 CCAGCCTGGGCGGGGCGCGGTGG - Intronic
1017907895 6:158769362-158769384 CCCTCCTGGAAGAGGCGCGGAGG - Exonic
1018906300 6:168078324-168078346 CTTCCCGGGAGGGAGCGCTGAGG - Intronic
1019179744 6:170178795-170178817 CCTACAAGGATGGGGCGCGGGGG - Intergenic
1019539287 7:1544562-1544584 CCTGCCTCGAGGGGGAGCGTGGG - Exonic
1020106594 7:5424973-5424995 CCTCCCTGGAGGGGGCGCGGCGG - Intronic
1020114367 7:5467504-5467526 CCTCCCAGGCTGGGGTGCGGTGG - Intronic
1020142418 7:5619876-5619898 CCTCCCTGGCAGGGGAGTGGTGG + Intergenic
1020796789 7:12686811-12686833 CCGGCCTGTAGGGGGCGCGCAGG - Intergenic
1022087802 7:27086138-27086160 CTTCCCTGTTGGGGGCACGGTGG - Intergenic
1022324667 7:29320344-29320366 CCCCCCTGCAGGGGGCGAGGGGG - Intronic
1023064846 7:36367029-36367051 CCTCGGTGGCGGGGGCGCGGCGG + Intronic
1023845502 7:44117862-44117884 CCTCCCTGGAGGTGGGGTTGTGG - Intronic
1024006726 7:45229767-45229789 TCTCCCAGGAGGTGGCGTGGTGG - Intergenic
1027264788 7:76488363-76488385 CATCTCTGGTGGGGGCGGGGCGG + Intronic
1027316159 7:76986465-76986487 CATCTCTGGTGGGGGCGGGGCGG + Intergenic
1029263512 7:99320689-99320711 CATCCCTGGAGGTGGAGGGGTGG - Intergenic
1029291364 7:99504624-99504646 TCTCCCAGGAGGTGGCGCGCGGG - Intergenic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1031986348 7:128166935-128166957 CCTCCCTGGAGGAGGTGCGGGGG + Intergenic
1032395465 7:131586308-131586330 TCTCCCTGGAGGGGTGGAGGTGG + Intergenic
1032439951 7:131934953-131934975 CAACCCTGGAGGAGGGGCGGTGG + Intergenic
1034466425 7:151232629-151232651 CGTCCCGGGAGGGGGCGGGGCGG - Exonic
1035216503 7:157371533-157371555 CCTCCCAGGAGAGGTCGCGGAGG + Intronic
1035243960 7:157550473-157550495 CCTCCCTGGTGGAGCCGCTGTGG - Intronic
1039201031 8:35094386-35094408 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
1040530618 8:48263656-48263678 TCTCCCTGGTGGGGGCGGGTGGG + Intergenic
1041325999 8:56665091-56665113 CCACCCTGGGCCGGGCGCGGTGG - Intergenic
1041471271 8:58212031-58212053 CCTCTCTGCAGGGGGCGGTGGGG - Intergenic
1045259530 8:100559835-100559857 CCCACCTGCAGGGGGCGCGCCGG - Intergenic
1045305275 8:100952207-100952229 CCGCGCTGGAGGGCGAGCGGAGG + Intronic
1045582661 8:103498813-103498835 CCCTCCCGGAGGGGGCGGGGCGG - Intergenic
1047865226 8:129016376-129016398 CCTCCCTGGTGGGGACCTGGTGG - Intergenic
1049302732 8:141880260-141880282 CCTCCCTGGAAGGGGGTGGGAGG - Intergenic
1049562109 8:143317085-143317107 GCTTCCTGGAGGAGGCGCCGAGG - Intronic
1049604322 8:143521947-143521969 CCTCCCTGCTGGGGGCTCAGGGG + Intronic
1049681800 8:143922150-143922172 CCAGCATGGAGGAGGCGCGGCGG - Exonic
1049852378 8:144839854-144839876 CCACCCAGCAGGGGGCACGGTGG - Intronic
1051663643 9:19448118-19448140 GCTCCCTGCAGGGGGTGAGGTGG - Intronic
1053545302 9:39017454-39017476 CCTCGCCGGAGGGGGAGCGCAGG + Intergenic
1055066825 9:72127349-72127371 CCTTCCTGGGCTGGGCGCGGTGG + Intronic
1055352455 9:75403335-75403357 GCACCCTGGACCGGGCGCGGTGG - Intergenic
1056132344 9:83599056-83599078 CCTCCATGGAGCAGGCGAGGTGG - Intergenic
1056773814 9:89497707-89497729 CGTCCCAGGAGGGGCCCCGGGGG + Intronic
1057186312 9:93059152-93059174 CTTCCCCGGGAGGGGCGCGGAGG - Intronic
1057271765 9:93655688-93655710 CCTCCATGGAAGGGGGTCGGGGG - Intronic
1057448560 9:95136871-95136893 CCTCCCTGGAGGGAGCATGAGGG + Intronic
1058861374 9:109120144-109120166 TCTTCCTGGAGGGGGGGGGGGGG + Intergenic
1059234487 9:112750675-112750697 CCGCCCGGGAGGGGGCGGGGAGG - Intergenic
1059466049 9:114469524-114469546 CCTCCCTGGAGGCAGCTCTGTGG + Intronic
1060280620 9:122213552-122213574 CCTGCGGGGAGGGGGCGCGGAGG - Intronic
1061236930 9:129348789-129348811 GCTCCCTGGAGCTGGAGCGGTGG - Intergenic
1061272276 9:129550229-129550251 GGGCCCTGGAGGGGGCGCGAGGG - Intergenic
1061677512 9:132226751-132226773 CCTCCCAGGAGGGGCCCAGGAGG - Intronic
1061706689 9:132458333-132458355 TCTCCCTGGCGGGGGAGGGGGGG + Intronic
1061789573 9:133051957-133051979 CCTCTCTGGAGGGGCCGCTGGGG + Intronic
1062197598 9:135282869-135282891 GCTCCCTGGAGGGTGCATGGCGG + Intergenic
1062332532 9:136050999-136051021 GCTCCCGGGAGGGGCCGCGCTGG + Intronic
1062490055 9:136800569-136800591 TCTCCCTGGCGGGTGCGGGGCGG - Exonic
1203470669 Un_GL000220v1:114168-114190 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1203478490 Un_GL000220v1:158140-158162 CCTCCCTCGGGAGGGCGCGCGGG + Intergenic
1186104700 X:6193132-6193154 CCTCCCTGGGCCGGGCGCGGTGG + Intronic
1186515985 X:10166477-10166499 CCTCCATGGAGAGGGCACTGGGG - Intronic
1188205778 X:27355963-27355985 CCTCCTTGGGGGTGGCGGGGCGG - Intergenic
1189968649 X:46396387-46396409 CCTCCCAGATGGGGTCGCGGCGG + Intergenic
1190557646 X:51652563-51652585 ACTCCGGGGAGGGGGCGAGGTGG - Intergenic
1190830879 X:54058159-54058181 CCTTCCTGGACTGGGCGCAGTGG - Intergenic
1191257078 X:58284189-58284211 ACTCCCTGGGTGGGGCGCAGTGG + Intergenic
1194604518 X:95962988-95963010 CATCCCTGGAGGGATTGCGGAGG - Intergenic
1197831256 X:130645812-130645834 CCTGCCTGGAGGTGGTGCTGAGG - Intronic
1200120847 X:153789862-153789884 GCTTCCTGGAGGAGGTGCGGGGG - Intronic