ID: 1020107082

View in Genome Browser
Species Human (GRCh38)
Location 7:5427112-5427134
Sequence CTGGGTAAACAAAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 640}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020107082_1020107090 2 Left 1020107082 7:5427112-5427134 CCCTCATACTTTTGTTTACCCAG 0: 1
1: 0
2: 1
3: 34
4: 640
Right 1020107090 7:5427137-5427159 GGATAGGTGGCCAAAAACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020107082 Original CRISPR CTGGGTAAACAAAAGTATGA GGG (reversed) Intergenic
900039325 1:444145-444167 CTGGGTAAATAAAGATATTAAGG + Intergenic
900060757 1:679121-679143 CTGGGTAAATAAAGATATTAAGG + Intergenic
901250274 1:7772365-7772387 CTTGGTATACAACAGTCTGATGG - Intronic
902091683 1:13908696-13908718 CTTGGTAAACTAAAGCATGGTGG + Intergenic
903540014 1:24091590-24091612 ATGGGGAAACCAAAGTATGTGGG - Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
905025583 1:34847243-34847265 CTGGGCAAACAAAACTGGGAGGG + Intronic
906839289 1:49119438-49119460 CTGGGTAAATAACAAAATGAAGG - Intronic
908269282 1:62407327-62407349 CTGGTTAAAGAAAAGCAGGAGGG - Intergenic
908733019 1:67246552-67246574 CTGGGTAAATAACAAAATGAAGG - Intronic
909770638 1:79417043-79417065 CTGGGTACATAACAATATGAAGG + Intergenic
909807644 1:79891801-79891823 CTGGGTAAATAACAAAATGAAGG - Intergenic
910853444 1:91670709-91670731 CTGGGCATAAGAAAGTATGAGGG + Intergenic
910940902 1:92532686-92532708 CTGGGTAAATAACAAAATGAAGG + Intronic
910957126 1:92718443-92718465 CTGGGTAAATAACAAAATGAAGG + Intronic
911378063 1:97075945-97075967 TTGGTTGAACAAAAGGATGAAGG + Intergenic
911541087 1:99159477-99159499 CTGGGTAAATAACAAAATGAAGG - Intergenic
911595807 1:99797831-99797853 CTGGGTAAATAACAAAATGAAGG - Intergenic
911831537 1:102555820-102555842 AAGGCTAAACAAAAGTATCAAGG + Intergenic
911901485 1:103511636-103511658 CTGGGTAAATAACAAAATGAAGG + Intergenic
911954781 1:104220305-104220327 CTGGGTACACAACAAAATGAAGG - Intergenic
911963326 1:104335250-104335272 CTGGGTAAATAACAAAATGAAGG - Intergenic
912000975 1:104834340-104834362 CTGGGTAAATAACAAAATGAAGG + Intergenic
912615183 1:111092717-111092739 CTGGGTAAATAACAAAATGAAGG + Intergenic
912886117 1:113476462-113476484 CTGGGTAAATAACAAAATGAAGG - Intronic
913406587 1:118500350-118500372 ATGGATAAACAAAACTGTGATGG + Intergenic
913720105 1:121584399-121584421 CTGGGTAAATAACAAAATGAAGG - Intergenic
913933573 1:125010475-125010497 CTGGGTACATAAAAAAATGAAGG + Intergenic
915711619 1:157904731-157904753 CTGGGTAAATAACAAAATGAAGG + Intergenic
915991982 1:160527189-160527211 CTGGGTAAATAAAAAAATTAAGG - Intergenic
916973739 1:170051745-170051767 CTGGGTAAATAAAAAAATTAAGG + Intronic
917111527 1:171553708-171553730 CTGGATAAATAACAGAATGAAGG - Intronic
917579332 1:176358767-176358789 CTGGGTAAATAACAAAATGAAGG + Intergenic
917900506 1:179538432-179538454 CTGGGTAAACAACAAAATGAGGG - Intronic
918122907 1:181555601-181555623 TTGGGAAAACCAAGGTATGAAGG + Intronic
918156506 1:181851993-181852015 CTGGGTAAACAATAAAATTAAGG + Intergenic
918159552 1:181885113-181885135 CTGGGTAAATAATAAAATGAAGG + Intergenic
918353488 1:183682407-183682429 CTGGGTAAATAACAAAATGAAGG - Intronic
918633932 1:186752207-186752229 ATGGGTGAACAAAATGATGATGG - Intergenic
918881783 1:190133518-190133540 ATGGATTAAAAAAAGTATGATGG + Intronic
919063662 1:192666199-192666221 CTGGGTAAATAAAGAAATGAAGG - Intergenic
920700576 1:208215445-208215467 CTAGGTAGACAAATGGATGATGG + Intronic
921404299 1:214762386-214762408 TTGGGTAAACAATAGAATTAAGG - Intergenic
922927961 1:229366191-229366213 ATGGGTACACAAAAGCATGCAGG - Intergenic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923194206 1:231649297-231649319 CTGGGTAAATAACAAAATGAAGG - Intronic
923416483 1:233767391-233767413 CTGGGTAAATAACAAAATGAAGG - Intergenic
923431435 1:233924873-233924895 CTGGGTAAACAACGAAATGAAGG - Intronic
924392995 1:243583721-243583743 CTGGGTAAACAACAAAATCAAGG + Intronic
1064789215 10:18936766-18936788 CTGGGTAAATAACAAAATGAAGG - Intergenic
1065119094 10:22511469-22511491 CTGGGTAAATAACAAGATGAAGG - Intergenic
1065665885 10:28060190-28060212 CTGGTAAAACAAAACTTTGATGG - Intronic
1065944072 10:30591356-30591378 CGGGGAAAACAAAACTCTGATGG - Intergenic
1066751518 10:38662082-38662104 CTGGGTAAATAACAAAATGAAGG + Intergenic
1066953414 10:42143245-42143267 CTGGGTACACAACAAAATGAAGG - Intergenic
1066965519 10:42261013-42261035 CTGGGTAAATAACAAAATGAAGG - Intergenic
1067198986 10:44149645-44149667 CTGGGTAAATAACAAAATGAAGG - Intergenic
1067230868 10:44408944-44408966 CTGGGTAAATAACAAAATGAAGG - Intergenic
1067729030 10:48795819-48795841 CTGGGTCACCAAATGTATGCTGG + Intronic
1068169326 10:53373002-53373024 CTGGGTAAATAACAAAATGAAGG + Intergenic
1068210262 10:53911360-53911382 CTGGGTAAATAACAAAATGAAGG + Intronic
1068218564 10:54013659-54013681 CTGGGTAAACAATAAAATTAAGG + Intronic
1068513590 10:57997408-57997430 CTGTGTAAACAACAGTTTGTAGG + Intergenic
1070003343 10:72398191-72398213 CTGGGTAAATAACAAAATGAAGG + Intronic
1070284959 10:75076162-75076184 CTGGGAAAAGAATAGTAGGATGG + Intergenic
1070602151 10:77873481-77873503 CGGGGTAAACAGAATTATCAGGG - Intronic
1070632766 10:78099261-78099283 CTGGGTAAATAACAAAATGAAGG + Intergenic
1070852118 10:79573235-79573257 CTGGGTAAATAACAAAATGAAGG + Intergenic
1070981001 10:80647243-80647265 CTGCGTAAACAAACACATGATGG + Intergenic
1071193710 10:83132699-83132721 CTGGGTAAATAACAAAATGAAGG - Intergenic
1071373221 10:84974842-84974864 CTGGGTAAATAACAAAATGAAGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071698219 10:87901064-87901086 CTGGGTAAATAACAAAATGAAGG - Intronic
1072017350 10:91361724-91361746 CTGGGTAAATAACAAAATGAAGG - Intergenic
1072375435 10:94811122-94811144 CTGGGTAAATAACAAAATGAAGG - Intronic
1072515965 10:96183554-96183576 CTGGGTAAATAACAAAATGAAGG - Intronic
1073667804 10:105552967-105552989 CTGGGTACATAAAAAAATGAAGG + Intergenic
1073746131 10:106470073-106470095 CTGGGTAAATAACAAAATGAAGG + Intergenic
1074017555 10:109549192-109549214 CTGGGTAAATAACAAAATGAAGG + Intergenic
1074673477 10:115822180-115822202 CTGGGTAAATAACAAAATGAAGG + Intronic
1076965547 11:80055-80077 CTGGGTAAATAAAGATATTAAGG + Intergenic
1077710748 11:4534314-4534336 CTGGGTACACAACAAAATGAAGG + Intergenic
1077717085 11:4592433-4592455 TAGGGTACACAAAAGTATGCAGG + Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078429500 11:11277741-11277763 CTGGGTAAATAACAAAATGAAGG - Intronic
1079265162 11:18924025-18924047 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1079271598 11:18991925-18991947 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1079550880 11:21695776-21695798 CTGGGTAAATAACAAAATGAAGG - Intergenic
1079756897 11:24275093-24275115 CTTGGTATAGAAAAGTAGGATGG + Intergenic
1080200643 11:29665551-29665573 CTGGGTAAATAACGGAATGAAGG + Intergenic
1080744215 11:35093533-35093555 CTGGGTAAAAAACAAAATGAAGG + Intergenic
1081125293 11:39313749-39313771 CTGGGTAAACAACAAAATTAAGG + Intergenic
1081181123 11:39986950-39986972 CTGGGTATATAAAAAAATGAAGG + Intergenic
1081309001 11:41547666-41547688 CTGGGTAAATAACAAAATGAAGG + Intergenic
1082557173 11:54576492-54576514 CTGGGTAAACAATGAAATGAAGG + Intergenic
1082578082 11:54834046-54834068 CTGGGTACATAAAAAAATGAAGG + Intergenic
1082662630 11:55931577-55931599 TTGGGTAAACAAAAAAATTAAGG - Intergenic
1082924894 11:58534424-58534446 CTGGGTAAATAAAAAAATTAAGG + Intronic
1082945370 11:58752741-58752763 CTGGGTAAATAACAAAATGAAGG + Intergenic
1083003405 11:59318705-59318727 CTGGGTAAATAACAAAATGAAGG - Intergenic
1083009649 11:59384892-59384914 CTGGGTAAATAACAAAATGAAGG - Intergenic
1086085766 11:82953604-82953626 CTGGGTAAATAAAGAAATGAAGG - Intronic
1086129496 11:83385866-83385888 CTGGGTAAATAACAAAATGAAGG + Intergenic
1086312012 11:85546231-85546253 CTGGGTAAATAACAAAATGAAGG - Intronic
1086530752 11:87782143-87782165 CTGGGTAAATAACAAAATGAAGG + Intergenic
1086563433 11:88195928-88195950 TTGGGTAAACAATAATATTAAGG - Intergenic
1086645256 11:89211848-89211870 CTGGGTAAATAACAAAATGAAGG + Intronic
1086848245 11:91778378-91778400 CTGAGTGAACAAAAGTATTAAGG - Intergenic
1087363937 11:97195970-97195992 CTGGGTAAATAATGGAATGAAGG - Intergenic
1087460777 11:98444155-98444177 CTAAGGAAACGAAAGTATGATGG + Intergenic
1087598982 11:100288509-100288531 CTGGGTACACAAAGAAATGAAGG + Intronic
1087695030 11:101367038-101367060 CTGGGTAAATAACAAAATGAAGG - Intergenic
1087703516 11:101464046-101464068 CTGGGTAAACAATGAAATGAAGG - Intronic
1087898536 11:103614235-103614257 CTGGGTAAATAACAAAATGAAGG + Intergenic
1087925440 11:103913402-103913424 CTGGGTAAATAACAAAATGAAGG + Intronic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1088987488 11:114922547-114922569 TTGGATGAACAAAAGAATGATGG - Intergenic
1089248556 11:117140194-117140216 CTGGGTAAATAATAAAATGAAGG + Intergenic
1089485262 11:118840780-118840802 CTGTGTCAACAAAATGATGATGG - Intergenic
1090216041 11:124965881-124965903 CTGGGTAAATAACAAAATGAAGG - Intronic
1092304638 12:7286472-7286494 CTGGGTAAACAACAAAATTAAGG + Intergenic
1092327314 12:7546526-7546548 CTGGGTAAATAACAAAATGAAGG + Intergenic
1092333871 12:7611036-7611058 CTGGGTAAACAATAAAATTAAGG + Intergenic
1092398643 12:8151991-8152013 CTGGATAAACAACAAAATGAAGG - Intronic
1092639186 12:10484571-10484593 CTGGGTAAATAACAATATTAAGG + Intergenic
1092715020 12:11380053-11380075 CTGGGTACACAACAAAATGAAGG + Intronic
1093597440 12:20978979-20979001 CTGGGTAAATAACAAAATGAAGG - Intergenic
1094791253 12:33918149-33918171 CTGGGTAAATAACAAAATGAAGG - Intergenic
1095128650 12:38511227-38511249 CTGGGTAAATAACAAAATGAAGG + Intergenic
1095489928 12:42723065-42723087 CTGGGTAAATAACAAAATGAAGG - Intergenic
1095695143 12:45135363-45135385 CTGGGTACATAACAGAATGAAGG + Intergenic
1095793535 12:46193172-46193194 CTGGGTAAATAACAAAATGAAGG - Intronic
1095798736 12:46249236-46249258 CTGGGTAAATAACAAAATGAAGG + Intronic
1097450437 12:59732007-59732029 TGGGATAAACAAAAGTGTGAAGG + Intronic
1097460500 12:59856318-59856340 CTGGGTAAATAAAAAAATTAAGG - Intergenic
1097749836 12:63339763-63339785 CTGGGTAAATAATAAAATGAAGG + Intergenic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1097912031 12:64981013-64981035 CTGGGTAAATAACAAAATGAAGG - Intergenic
1098451963 12:70629347-70629369 CTGGGTAAATAACAAAATGAAGG + Intronic
1098797002 12:74901999-74902021 ATGGGTATACAAAAGTTTGCAGG - Intergenic
1098993635 12:77093690-77093712 CTGGGTAAATAACAAAATGAAGG - Intergenic
1099053189 12:77806406-77806428 CTGGGTAAATAACAAAATGAAGG - Intergenic
1099431180 12:82588049-82588071 CTGGGTAAATAACAAAATGAAGG + Intergenic
1099765152 12:86973288-86973310 CTGGGTACACAACAAAATGAAGG + Intergenic
1099767397 12:87005492-87005514 CTGGGTAAACAACAAAATTAAGG - Intergenic
1099820211 12:87699511-87699533 CTGGGTAAATAACAAAATGAAGG - Intergenic
1099878719 12:88439868-88439890 CTGGGTAAATAAAAAAATTAAGG + Intergenic
1100323565 12:93519775-93519797 CTGGATAAACACAAGGATTAGGG - Intergenic
1100652104 12:96602196-96602218 CTGGGTAAATAACAAAATGAAGG - Intronic
1100901056 12:99240798-99240820 CTGGGTAAATAACAAAATGAAGG + Intronic
1101206326 12:102491732-102491754 CTGGGTAAATAACAAAATGAAGG - Intergenic
1101309902 12:103567520-103567542 CTGGGTAAACAATAATATAAAGG + Intergenic
1105375609 13:19841711-19841733 CTGTTTATACAAAAGTATGTGGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1107439847 13:40416138-40416160 CTGGGTAAATAACAAAATGAAGG + Intergenic
1107536522 13:41340569-41340591 CTGGGTAAATAACAAAATGAAGG - Intronic
1107931283 13:45309769-45309791 CTGGCTAAAAAAAAGTATGTAGG - Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108673749 13:52718582-52718604 CTGGGTAAATAACAAAATGAAGG - Intronic
1108865769 13:54920622-54920644 CTGGGTAAATAATAAAATGAAGG + Intergenic
1108989037 13:56631671-56631693 CTGGGTAAATAACAAAATGAAGG + Intergenic
1108998579 13:56766044-56766066 CTGGGTAAATAACAAAATGAAGG + Intergenic
1109293984 13:60507589-60507611 CTGGGTAAATAAAAAAATTAAGG + Intronic
1109675670 13:65673031-65673053 CTGGGTAAATAACAAAATGAAGG - Intergenic
1110199438 13:72831505-72831527 CTGGGTAAACAACGAAATGAAGG - Intronic
1110878546 13:80541171-80541193 CTGGGTAAATAACAGAATTAAGG - Intergenic
1111341821 13:86896770-86896792 CTGGGTAAATAACAAAATGAAGG + Intergenic
1111432954 13:88167455-88167477 ATGGATAAACTAAATTATGATGG + Intergenic
1112605394 13:100899863-100899885 CTGGGCAGACAGAAGTGTGAAGG + Intergenic
1113342916 13:109444708-109444730 CTGGGTAAATAACAAAATGAAGG - Intergenic
1114255982 14:21001656-21001678 CTGAGTAAAGAAATGTCTGAGGG - Exonic
1114608350 14:24016631-24016653 CTGGGTAAATAACAAAATGAAGG + Intergenic
1115637030 14:35299676-35299698 CAGGGTAAACAGTAGTATCATGG - Intronic
1115869478 14:37783871-37783893 CTGGGTAAATAACAAAATGAAGG - Intronic
1115968115 14:38914786-38914808 CTGGGTAAACAATGAAATGAAGG + Intergenic
1116052595 14:39823261-39823283 CTGGGTAAATAACAAAATGAAGG - Intergenic
1116210041 14:41926462-41926484 TTGGATAAATAAAAATATGAGGG + Intergenic
1116417433 14:44695813-44695835 CTGGGTAAATAACAGGATGAAGG + Intergenic
1116445568 14:45005668-45005690 CTGGGGAAAGAAAATCATGAGGG - Intronic
1116475283 14:45331933-45331955 CGGTGTAAAGAAAAGAATGAGGG - Intergenic
1116565689 14:46441383-46441405 CTGGGTAAATAACAGAATTAAGG + Intergenic
1116639466 14:47442605-47442627 TTGGGCAAACAAAAGTTTAAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117121364 14:52571237-52571259 CTGGGTAAATAACAAAATGAAGG + Intronic
1117796772 14:59402958-59402980 CTGGGTAAATAACAAAATGAAGG - Intergenic
1117822615 14:59666341-59666363 CTGGGTAAATAACAAAATGAAGG + Intronic
1118829701 14:69419241-69419263 CTGGGTAAACAACGAAATGAAGG - Intronic
1119594644 14:75923450-75923472 CTGGGTAAATAACAAAATGAAGG - Intronic
1119930306 14:78539847-78539869 CTGGGTAAATAACAAAATGAAGG - Intronic
1120394132 14:83945738-83945760 CTTAGTAAACAAACATATGAAGG + Intergenic
1120797809 14:88654520-88654542 CTGGGTAAATAACAGAATTAAGG - Intronic
1123148892 14:106162071-106162093 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1123428959 15:20198069-20198091 CTGGGTAAATAACAAAATGAAGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124838588 15:33220164-33220186 TTGGGTAAACAAAAAAATTAAGG + Intergenic
1125329722 15:38570849-38570871 CTGGGTAAATAAAAAAATGAAGG - Intergenic
1125837633 15:42767034-42767056 CTGGGTAAATAACAAAATGAAGG + Intronic
1126051167 15:44686309-44686331 CTGGGTAAATAACAATATTAAGG + Intronic
1126071523 15:44869030-44869052 CTGGGTAAACAAAGAAATTAAGG + Intergenic
1126720349 15:51571686-51571708 CTGGGTAAATAACAAAATGAAGG + Intronic
1127524764 15:59781906-59781928 CTGGGTAAATAACAACATGAAGG - Intergenic
1127570878 15:60240054-60240076 CTGGGTAAATAACAAAATGAAGG + Intergenic
1129127055 15:73450886-73450908 CTGGGTAAATAAAGAAATGAAGG + Intronic
1131065167 15:89430059-89430081 CTGGGGCAACAAAAATATAAGGG - Intergenic
1131988935 15:98073758-98073780 CTGGGTAAACAACAAAATTAAGG - Intergenic
1132116638 15:99141601-99141623 TTGAGTAAAAAAAAGTGTGAGGG + Intronic
1132442588 15:101883464-101883486 CTGGGTAAATAAAGATATTAAGG - Intergenic
1133555745 16:6904937-6904959 CTGGGTAAACAAAAGCAGTGGGG + Intronic
1133610975 16:7433041-7433063 CTGGGAAAACAAGATTATGCGGG - Intronic
1133703573 16:8332235-8332257 CCAGGTAAACAAAACTTTGAGGG + Intergenic
1136681334 16:31965511-31965533 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1136731202 16:32415025-32415047 CTGGGTAAATAACAAAATGAAGG - Intergenic
1136781641 16:32907023-32907045 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1136888149 16:33946817-33946839 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1137347771 16:47681010-47681032 CTGGGTAAATAACAAAATGAAGG - Intronic
1137503683 16:49031585-49031607 CTGGGTACACAAAGAAATGAAGG + Intergenic
1137808803 16:51332690-51332712 CTGGGTACACAAAGAAATGAAGG + Intergenic
1138260638 16:55618332-55618354 CTGGGTAAATAATAAAATGAAGG + Intergenic
1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG + Intergenic
1139629414 16:68219602-68219624 CTGGGTAAACAATTTTATGAAGG - Intronic
1140885947 16:79242951-79242973 CTGGGTAAATAACAAAATGAAGG + Intergenic
1142436667 16:90063593-90063615 CTGGGTAAGAAAAAATTTGAGGG - Exonic
1202995189 16_KI270728v1_random:102246-102268 CTGGGTAAATAACAAAATGAAGG + Intergenic
1203021876 16_KI270728v1_random:414588-414610 CTGGGTAAATAACAAAATGAAGG + Intergenic
1203084299 16_KI270728v1_random:1171005-1171027 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1142791003 17:2265830-2265852 CTGGTTAAAATAAAGTGTGATGG + Intronic
1147170930 17:38618396-38618418 CTTAGTAAACAAAAGCATGTGGG - Intergenic
1149240407 17:54642098-54642120 CTGGGTAAATAACAAAATGAAGG + Intergenic
1150147718 17:62783277-62783299 CTGGGTAAATAACAAAATGAAGG + Intronic
1150422768 17:65053720-65053742 CTTTTTAAACAAAGGTATGAGGG - Exonic
1151032989 17:70763414-70763436 CTGGGAACACAGAAGTCTGATGG - Intergenic
1153095846 18:1401924-1401946 CTAGGGAAACAAAGCTATGAAGG - Intergenic
1153441530 18:5124888-5124910 CTGGGTAAATAACAAAATGAAGG + Intergenic
1154288313 18:13081845-13081867 CTGGGTAAATAACAAAATGAAGG - Intronic
1155295541 18:24381266-24381288 CTGGGTAAACCAAACTAACAGGG + Intronic
1156298259 18:35812307-35812329 CTGGGTAAATAACAAAATGAAGG + Intergenic
1156414797 18:36876916-36876938 CTGGGTAAATAACAAAATGAAGG - Intronic
1156433298 18:37099315-37099337 CTGGGTACACAACAAAATGAAGG - Intronic
1156765915 18:40654705-40654727 CTGGGAAGACAATAGAATGAAGG - Intergenic
1157057986 18:44253480-44253502 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1157106681 18:44780593-44780615 CTGGATAAACGAATATATGAAGG - Intronic
1157355108 18:46926325-46926347 CTGGGTAAATAACAAAATGAAGG - Intronic
1157561722 18:48651867-48651889 CTGGGTAAATAACAAAATGAAGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158413269 18:57226755-57226777 CTGGGTAAATAACAAAATGAAGG + Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159333540 18:67032789-67032811 CTGAGTAAATAAAAGCCTGAAGG - Intergenic
1160289046 18:77573236-77573258 CTGGGGAAAAGAAAGTAAGAAGG - Intergenic
1160642351 19:149685-149707 CTGGGTAAATAAAGATATTAAGG + Intergenic
1161934599 19:7363919-7363941 ATGGATAAATAAAAGAATGAAGG + Intronic
1163380504 19:16963940-16963962 CTGGGTAAATAACGGAATGAAGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165563948 19:36706958-36706980 ATAGGTAAATAAAAGTATAAAGG - Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926366329 2:12136696-12136718 CTGGGTAAATAACAAAATGAAGG - Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
928691986 2:33809437-33809459 CCAGGTAAACAAAAGTAACAAGG - Intergenic
928754451 2:34507500-34507522 CTGGGTAAATAACAAAATGAAGG + Intergenic
928883247 2:36121178-36121200 CTGGGTAAATAACAAAATGAAGG - Intergenic
930264449 2:49183744-49183766 CTGGGTAAATAACAAGATGAAGG - Intergenic
930905870 2:56566737-56566759 CTGGGAAATAAAAAGGATGAGGG - Intergenic
930908650 2:56604068-56604090 CTGGGTAAATAACAAAATGAAGG - Intergenic
931594784 2:63929416-63929438 CTGGGTAAATAACAAAATGAAGG + Intronic
931985910 2:67742198-67742220 CTGGGTAAATAACAAAATGAAGG - Intergenic
932051294 2:68400971-68400993 CTGGGTAAATAACAAAATGAAGG - Intergenic
932052095 2:68408106-68408128 CTGGGTAAATAACAAAATGAAGG + Intergenic
932540401 2:72645692-72645714 CTGGGTAAATAAAAAAATGGAGG + Intronic
932914155 2:75836877-75836899 CTGGGTAAATAACAAAATGAAGG + Intergenic
933154302 2:78954866-78954888 CTGGGTAAACTTATATATGATGG - Intergenic
933607534 2:84399476-84399498 CTGGGTAAATAACAAAATGAAGG + Intergenic
933801828 2:85966683-85966705 CTGGGTACATAAAGGAATGAAGG + Intergenic
934314505 2:91904234-91904256 CTGGGTAAATAACAAAATGAAGG + Intergenic
934676099 2:96250689-96250711 CTGTGTGATCAAATGTATGAAGG + Exonic
934836970 2:97599274-97599296 CTGGGTAAATAATAAAATGAAGG - Intergenic
935273662 2:101457448-101457470 CTGGATAAATAAAAAAATGAAGG - Intronic
935567675 2:104626951-104626973 CTGGGTAAATAACAAAATGAAGG - Intergenic
936385561 2:112025379-112025401 CAGGGTAAATAATAGTGTGAGGG - Intronic
936806168 2:116335011-116335033 CTGGGTAAACAACAAAATGAAGG - Intergenic
937763171 2:125629693-125629715 CTGGGAAAACAAAAGAAACAAGG + Intergenic
938975327 2:136471593-136471615 CTGGGTAAATAACAAAATGAAGG + Intergenic
939711150 2:145521425-145521447 CTGGGTAAATAACATAATGAAGG + Intergenic
939753324 2:146076176-146076198 CTGGGTAAATAACAAAATGAAGG + Intergenic
940437577 2:153672453-153672475 CTGGGTAAATAAAGAAATGAAGG + Intergenic
940824772 2:158398528-158398550 CTGGGTAAATAACAAAATGAAGG + Intronic
941157297 2:161995221-161995243 CTGACAAAACAAAAGCATGAGGG - Intronic
942392139 2:175506363-175506385 CTGGGTAAACAACGAAATGAAGG + Intergenic
942734077 2:179090643-179090665 CTGGGTAAACAAGGAAATGAAGG - Intergenic
942875088 2:180785646-180785668 CTGGGTAAATAACAAAATGAAGG - Intergenic
943236059 2:185321444-185321466 CTGGTTAAAAAAAAGTTAGATGG - Intergenic
943556244 2:189407884-189407906 CTGGGAAAATAAAAATATTAAGG + Intergenic
943807542 2:192140980-192141002 CTGGGTATACAAAAGTGAGTGGG + Intronic
943971031 2:194406405-194406427 CTGGGTAAATAATGATATGAAGG + Intergenic
944249328 2:197565720-197565742 CTGGGTAAATAACAAAATGAAGG - Intergenic
944375014 2:199031338-199031360 CTGGGTAAATAACAAAATGAAGG + Intergenic
944381074 2:199111452-199111474 GTGGGTAAACCAAAGTGTGCTGG + Intergenic
947357388 2:229311098-229311120 CTGGGTAAAGCATAGTATGGAGG + Intergenic
947494321 2:230622499-230622521 CTGGGTAAATAACAAAATGAAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1168999032 20:2153559-2153581 CTGGGTAAACACTAGTTGGAGGG - Intronic
1169796098 20:9464180-9464202 CTGGGTAAATAATGGAATGAAGG + Intronic
1169971488 20:11273457-11273479 CTGGGTGAATAAAAATATGGAGG + Intergenic
1170050778 20:12142731-12142753 CTGGGTAAACAAAAAAATTAAGG - Intergenic
1170186483 20:13596432-13596454 CTGGGTAAATAACAAAATGAAGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171082106 20:22197015-22197037 CTGGGTAAACAACGAAATGAAGG + Intergenic
1171256871 20:23695370-23695392 CTGGGTAAATAATAAAATGAAGG + Intergenic
1171273895 20:23838367-23838389 CTGGGTAAATAACAAAATGAAGG + Intergenic
1171434352 20:25108145-25108167 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1171443263 20:25184070-25184092 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1174654972 20:52163786-52163808 CTTGTTAAAAAAAAGTCTGAAGG + Intronic
1174877274 20:54240911-54240933 CTGGGTAAATAACAAAATGAAGG + Intergenic
1175003321 20:55654148-55654170 CTGGGTAAACAACGAAATGAAGG + Intergenic
1175071714 20:56339666-56339688 CTGGGTAAATAACAAAATGAAGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177721888 21:24917831-24917853 CTGGGTAAATAACAAAATGAAGG - Intergenic
1177859833 21:26439377-26439399 CTGGGCAAACCACAATATGATGG + Intergenic
1178159981 21:29901039-29901061 CTGGGTAAATAAAGAAATGAAGG + Intronic
1178370559 21:32023582-32023604 CTGGGGAAAGAAAAGTCAGAGGG - Intronic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1180250100 21:46579693-46579715 CTGGGTAAACAATAAAATTAAGG - Intergenic
1180541275 22:16450115-16450137 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1181445496 22:22969921-22969943 CTGGGTAAATAACAAAATGAAGG + Intergenic
1203324318 22_KI270737v1_random:103116-103138 CTGGGTAAATAACAAAATGAAGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
951450241 3:22829224-22829246 CTGGGTAAATAACAAAATGAAGG + Intergenic
951618017 3:24569647-24569669 CTGGGTAAATAACGATATGAAGG + Intergenic
951676165 3:25244552-25244574 CTGGGTAAACAACAAAATGAAGG - Intronic
951776867 3:26320169-26320191 CTGGGTAAATAAAGAAATGAAGG - Intergenic
951985983 3:28621486-28621508 CTGGGTAAATAATAAAATGAAGG + Intergenic
952118502 3:30213620-30213642 CTGGGTACATAACAGAATGAAGG - Intergenic
952550310 3:34469540-34469562 CTGGGTAAATAACAAAATGAAGG - Intergenic
953053200 3:39364750-39364772 CTGGGTAAACAATAAAATTAAGG + Intergenic
955593740 3:60566001-60566023 CTGGGTACATAAAAAAATGAAGG - Intronic
956668702 3:71665850-71665872 CTGGGTAAATAACAAAATGAAGG + Intergenic
956862204 3:73336093-73336115 CTGGGTAAATAACAAAATGAAGG - Intergenic
957353056 3:79050810-79050832 CTGGGTAAATAACAAAATGAAGG + Intronic
957917598 3:86706568-86706590 CTGGGTAAATAACAAAATGAAGG - Intergenic
958191504 3:90190889-90190911 CTGGGTAAATAACAAAATGAAGG - Intergenic
958413707 3:93849986-93850008 CTGGGTAAACAACAAAATGAAGG - Intergenic
958447986 3:94238568-94238590 CTGGGTAAATAAAGAAATGAAGG - Intergenic
958684446 3:97375014-97375036 CTGGGTACACAAAATTAACAAGG + Intronic
958742634 3:98093638-98093660 CTGGGTAAATAACAAAATGAAGG - Intergenic
958899848 3:99872839-99872861 CTGGGCAAACAAAAATGGGAAGG - Intronic
959189671 3:103095687-103095709 ATGGTTAAACAAAAGTACAAGGG - Intergenic
959528193 3:107401303-107401325 CTGGGTGAAGTAAAGTATGGAGG + Intergenic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
959816075 3:110674477-110674499 CTGGGTAAATAACAAAATGAAGG + Intergenic
960065647 3:113369479-113369501 CTGGGTAAATAACAAAATGAAGG + Intronic
960177575 3:114534891-114534913 CTGGGTAAACAACAAAATTAAGG + Intronic
960787434 3:121389625-121389647 CTGGGTAAATAACAAAATGAAGG - Intronic
960812148 3:121635669-121635691 CTGGGGAAGAAAAAGAATGAGGG + Intronic
960832106 3:121860911-121860933 CTGGGTAAATAACAAAATGAAGG - Intronic
960835788 3:121905589-121905611 CTGGGTAAATAACAAAATGAAGG - Intronic
961992803 3:131210224-131210246 CTGGGTAAATAACAAAATGAAGG - Intronic
962157141 3:132959626-132959648 CTGGGTAAATAACAAAATGAAGG + Intergenic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
962819020 3:139028829-139028851 CTGGGTAAATAACAAAATGAAGG + Intronic
962861570 3:139407480-139407502 CTGGGTAAATAACAAAATGAAGG + Intergenic
962913828 3:139880688-139880710 CTGGGTAAATAATAAAATGAAGG - Intergenic
963531778 3:146479987-146480009 CTGGGTAAATAACAAAATGAAGG + Intronic
964036369 3:152203417-152203439 CTGGTTAAAAAAAAGTGGGAAGG - Intergenic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
964171205 3:153771549-153771571 TTGGGTAAACAATAATATTAAGG + Intergenic
964694692 3:159494003-159494025 CTGGGTACATAAAAAAATGAAGG + Intronic
964836606 3:160946177-160946199 CTGGGCTAAGAAAAGTAAGATGG - Intronic
965325036 3:167292451-167292473 CTGGGTAAATAACAAAATGAAGG + Intronic
965393310 3:168131188-168131210 CTGGGTAAATAACAAAATGAAGG + Intergenic
965983711 3:174725363-174725385 CTAGGTAAATAAAAGTGGGATGG - Intronic
966477828 3:180370262-180370284 CTGGGTAAATAAAGAAATGAAGG + Intergenic
967343380 3:188426192-188426214 CTGGGTAAATAACAAAATGAAGG - Intronic
967629860 3:191732968-191732990 CTGGGTAAATAACAAAATGAAGG + Intergenic
968375639 4:38579-38601 CTGGGTACATAACAGAATGAAGG - Intergenic
969692827 4:8714044-8714066 GTGGTTAAACAAAAGACTGAGGG + Intergenic
970917736 4:21355052-21355074 CTGGGTAAATAACAAAATGAAGG + Intronic
971359362 4:25922634-25922656 CTGGGGAATGAAATGTATGAAGG - Intronic
971586425 4:28410173-28410195 CTGGGTACACAACAAAATGAAGG + Intergenic
972131990 4:35848864-35848886 CTGGGTAAACAATAAAATTAAGG - Intergenic
972368887 4:38402385-38402407 CTGGGTAAACAACAAAATTAAGG - Intergenic
972480681 4:39493128-39493150 TTTGTTAAACAAAAGTAAGACGG + Intergenic
972914581 4:43860057-43860079 CTGGGTAAATAACAAAATGAAGG - Intergenic
973093099 4:46162963-46162985 CTGGGGAGACAAAGGCATGACGG + Intergenic
973799545 4:54462999-54463021 CTGGGTAAATAACAAAATGAAGG + Intergenic
974023934 4:56715513-56715535 CTGGGTAAATAACAAAATGAAGG + Intergenic
974230965 4:59112993-59113015 CTGGGTAAACAAAAAAATGAAGG - Intergenic
974754423 4:66184927-66184949 ATGTCCAAACAAAAGTATGAAGG - Intergenic
975306358 4:72853672-72853694 CTGGGTAAATAACAAAATGAAGG + Intergenic
975449557 4:74508232-74508254 CTGGGTAAACAACAAAATGAAGG + Intergenic
975500303 4:75077468-75077490 CTGGGTAAATAACAAAATGAAGG - Intergenic
975524557 4:75334423-75334445 CTGGGTAAACAATGAAATGAAGG + Intergenic
975528985 4:75381009-75381031 CTGGGTAAATAATAAAATGAAGG + Intergenic
975750843 4:77521950-77521972 CTGGGTAAATAACAAAATGAAGG - Intronic
976156835 4:82154865-82154887 CTGGGTAAATAAAGAAATGAAGG + Intergenic
976159830 4:82187017-82187039 CTGGGTAAATAACAAAATGAAGG + Intergenic
976272354 4:83243700-83243722 CTGGGTAAATAACAAAATGAAGG + Intergenic
976552326 4:86411141-86411163 CTGGGTAAACAACAAAATTAAGG - Intronic
976760324 4:88541847-88541869 CTGGGTAAATAACAAAATGAAGG + Intronic
976861770 4:89674203-89674225 CTGGGTAAATAACAAAATGAAGG + Intergenic
977291954 4:95174483-95174505 CTGGGTAAATAACAAAATGAAGG - Intronic
977515944 4:98021259-98021281 CTGGGTAAATAACAAAATGAAGG - Intronic
977516987 4:98032844-98032866 CTGGGTAAATAACAAAATGAAGG + Intronic
977771462 4:100866045-100866067 CTGGGTAAATAACAAAATGAAGG - Intronic
977946738 4:102922311-102922333 CTGGGTAAATAACAAAATGAAGG + Intronic
978006902 4:103628046-103628068 CTGGGTAAACAATAAAATGAAGG + Intronic
978115670 4:105017478-105017500 CTGGGTAAATAACAAAATGAAGG + Intergenic
978254083 4:106672768-106672790 CTGGGTACACAACAAAATGAAGG + Intergenic
978346331 4:107773932-107773954 CTGGGGAAAAAAAGGTATGTGGG + Intergenic
978382816 4:108147956-108147978 TTGGGCAAACAATATTATGAAGG - Intronic
978464810 4:108996877-108996899 CTGGGTAAACAACGAAATGAAGG + Intronic
978773059 4:112477823-112477845 CTGGGTAAATAACAAAATGAAGG - Intergenic
979031438 4:115653415-115653437 CTGGGTAAATAACAAAATGAAGG - Intergenic
979115550 4:116817957-116817979 CTGGGTAAATAAAAAAATGAAGG + Intergenic
979729883 4:124011631-124011653 CTGGGTAAATAATAAAATGAAGG - Intergenic
980037550 4:127902741-127902763 CTGGGTAAATAACAAAATGAAGG - Intergenic
980157347 4:129123769-129123791 CTGGGTAAATAAAGAAATGAAGG - Intergenic
981131844 4:141165699-141165721 CTGGGTAAATAACAGAATTAAGG + Intronic
982623751 4:157738152-157738174 CTCGGGAAACAAAAGCATGGTGG + Intergenic
983594567 4:169451537-169451559 CTGGGTAAATAAAAAAATGAAGG + Intronic
983694165 4:170508329-170508351 CTGGGTAAATAACAAAATGAAGG - Intergenic
984221618 4:176984554-176984576 TTGGGTAAACAACAGCATTAAGG + Intergenic
984224673 4:177020110-177020132 CTGGGTAAATAACAAAATGAAGG + Intergenic
985182270 4:187278207-187278229 CTGGTTAAAATAAATTATGAGGG + Intergenic
985473521 5:63335-63357 CTGGGTAAATAACAAAATGAAGG - Intergenic
986341333 5:6791747-6791769 ATGGGTACACAATATTATGAAGG - Intergenic
986654125 5:9993606-9993628 CTGGGTATACAACAAAATGAAGG + Intergenic
987180172 5:15359019-15359041 CTGGGTAAATAACAAAATGAAGG + Intergenic
987225484 5:15836104-15836126 CAGGGTAAACAAAATTCAGATGG + Intronic
988172539 5:27678273-27678295 CTGGGTAAATAACAAAATGAAGG + Intergenic
988391290 5:30635987-30636009 TTGGGAAAACAAAAGAATGCTGG - Intergenic
989345025 5:40420441-40420463 CTGGGTAAATAACAAAATGAAGG - Intergenic
989522187 5:42415554-42415576 CTGGGTAAATAATAAAATGAAGG - Intergenic
989670860 5:43915120-43915142 TTGGGTAAATAAAAAAATGAAGG + Intergenic
989670889 5:43915655-43915677 CTGGGTAAATAACAAAATGAAGG - Intergenic
989781476 5:45270095-45270117 CAAGGAAAACAAAAGTATTATGG - Intronic
990224016 5:53629119-53629141 CTGGGTAAATAACAAAATGAAGG - Intronic
991387782 5:66108833-66108855 CTGGGTAAATAAAGAAATGAAGG + Intergenic
991535350 5:67664060-67664082 CTGGGTACATAAAAACATGAAGG - Intergenic
991652347 5:68868165-68868187 CTGGGTAAATAAAAAAATTAAGG + Intergenic
992819000 5:80475490-80475512 GAGGATAAAGAAAAGTATGAAGG - Intronic
993291734 5:86080859-86080881 CTGGGTAAATAACAAAATGAAGG - Intergenic
993497167 5:88620686-88620708 CTGGGTAAATAACAAAATGATGG - Intergenic
993656044 5:90579346-90579368 CTGGGTAAATAACAAAATGAAGG - Intronic
993674237 5:90797829-90797851 CTGGGTAAATAACAAAATGAAGG + Intronic
993929925 5:93925543-93925565 CTGAGTAAAACAAAGTAGGATGG + Intronic
993947725 5:94135690-94135712 CTGGGTAAACAACGAAATGAAGG - Intergenic
994039977 5:95247631-95247653 CTGGGTAAATAACAAAATGAAGG - Intronic
994345645 5:98682685-98682707 CTGGGTAAATAACAAAATGAAGG + Intergenic
994378363 5:99040525-99040547 CTGGGTAAATAACAAAATGAAGG + Intergenic
994574711 5:101563342-101563364 AGGGGTAAAGAAAAGTATGACGG + Intergenic
995093638 5:108210551-108210573 CTGGGTAAATAATAAAATGAAGG - Intronic
995108548 5:108402134-108402156 CTGGGTAAATAACAAAATGAAGG + Intergenic
995398413 5:111714434-111714456 CTGGGTAAACAACAAAATTAAGG - Intronic
995460011 5:112392991-112393013 CTGGGTAAATAACAAAATGAAGG + Intronic
997012168 5:129891647-129891669 CTGGGTAAATAACAAAATGAAGG - Intergenic
997343641 5:133168446-133168468 CTGGGTAAATAACAAAATGAAGG - Intergenic
998723878 5:144986682-144986704 CTGGGTAAACAACAAAATGAAGG - Intergenic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
999557077 5:152754850-152754872 CTGGGTAAATAACAAAATGAAGG + Intergenic
1000460788 5:161515244-161515266 TTGGGTAAATAAAAGTAAAAAGG + Intronic
1001575273 5:172759236-172759258 CTGGGAAAAGAAAAGTCAGAGGG + Intergenic
1001656764 5:173356631-173356653 ATGGGAAAACACAAGTATGTTGG + Intergenic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002540365 5:179902645-179902667 CTGGGGAGAGAAAAGTACGAGGG - Intronic
1002734522 5:181374798-181374820 CTGGGTAAATAAAGATATTAAGG - Intergenic
1002750012 6:99324-99346 CTGGGTAAATAAAGATATTAAGG + Intergenic
1002856470 6:1042504-1042526 TTGGGCAAACAAATGTAGGAAGG + Intergenic
1003228925 6:4231891-4231913 CTGGGTAAATAACAAAATGAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005747462 6:28851667-28851689 CTGGGTAAATAACAAAATGAAGG + Intergenic
1006737882 6:36287636-36287658 CTGGTTAAACAAATCTATGCTGG - Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008088820 6:47272416-47272438 CTGGGTAAATAACAAAATGAAGG + Intronic
1008207639 6:48682863-48682885 CTGGGTAAATAACAAAATGAAGG + Intergenic
1008436596 6:51483613-51483635 CTGGGTAAATAACAAAATGAAGG - Intergenic
1008865707 6:56206940-56206962 CTGGGTAAATAACAAAATGAAGG + Intronic
1008961563 6:57271868-57271890 CTGGGTAAATAACAAAATGAAGG - Intergenic
1009241063 6:61186360-61186382 CTGGGTAAATAACAAAATGAAGG + Intergenic
1009323032 6:62314935-62314957 CTGGGTACACAACAAAATGAAGG + Intergenic
1009384602 6:63073504-63073526 CTGGGTAAATAACAAAATGAAGG - Intergenic
1009393510 6:63169861-63169883 CTGGGTAAATAACAAAATGAAGG + Intergenic
1009628914 6:66169370-66169392 CTGGGTAAATAACAAAATGAAGG + Intergenic
1009877048 6:69517904-69517926 CTGGGTAAATAACAAAATGAAGG + Intergenic
1010006515 6:71000896-71000918 CTGGGTAAATAACAAAATGAAGG + Intergenic
1010459723 6:76100285-76100307 CTGGGTAAATAACAAAATGAAGG + Intergenic
1010599083 6:77801715-77801737 CTGGGTACACAACAAAATGAAGG - Intronic
1010704437 6:79090278-79090300 CTGGGTCAAAAAAAGAATAAAGG - Intergenic
1010747507 6:79580543-79580565 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1010758591 6:79696056-79696078 CTGGGTAAACAAAGCTGTAAAGG - Intronic
1010831039 6:80529541-80529563 CTCCTTAAACAAAAGTTTGAGGG + Intergenic
1010838157 6:80614992-80615014 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1010947178 6:81989062-81989084 TCGAGTAAACAAAAGTATTAAGG + Intergenic
1011041811 6:83037836-83037858 CTGGGGAACCAAAAGAATAAGGG + Intronic
1011209445 6:84938895-84938917 CTGGGTAAATAACAAAATGAAGG + Intergenic
1011213783 6:84982942-84982964 CTGGGTAAATAACAAAATGAAGG + Intergenic
1011235316 6:85210389-85210411 CTGGGTAAATAACAAAATGAAGG - Intergenic
1011235767 6:85214696-85214718 CTGGGTAAATAACAAAATGAAGG + Intergenic
1011585090 6:88916144-88916166 CTGGTAAAACCACAGTATGAGGG - Intronic
1011924675 6:92627241-92627263 CTGGGTACACAACAAAATGAAGG + Intergenic
1012209026 6:96497577-96497599 CTGGGTACATAAAAAAATGAAGG - Intergenic
1012598248 6:101064897-101064919 CTGGGTAAACAACAAAATGAAGG + Intergenic
1013319952 6:108978239-108978261 CTGGGTAAATAACAAAATGAAGG - Intergenic
1013426463 6:110017316-110017338 CTGGGTAGACAAGAGGATGGTGG + Intergenic
1013860618 6:114631241-114631263 CTGGGTAAATAACAAAATGAAGG - Intergenic
1013906417 6:115224959-115224981 CTGGGTAAATAACAAAATGAAGG + Intergenic
1013957447 6:115856869-115856891 CTGGGTAAATAACAAAATGAAGG + Intergenic
1014128215 6:117801922-117801944 CTGGGTAAATAACAAAATGAAGG - Intergenic
1015129488 6:129793529-129793551 CTGGGGAAACCAAAGAATAAAGG + Intergenic
1015658678 6:135548295-135548317 ATGTGTAAACAAAAATACGAAGG + Intergenic
1015931548 6:138365565-138365587 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1015967444 6:138709153-138709175 CTGGGTAAATAACAAGATGAAGG - Intergenic
1016494642 6:144646687-144646709 CTGGGAAAGCAAATGTATCAGGG + Intronic
1016523627 6:144974964-144974986 CTGGGTAAATAACGGAATGAAGG - Intergenic
1016655378 6:146512895-146512917 CTGGGTAAATAACAAAATGAAGG - Intergenic
1016690066 6:146927589-146927611 CTGGTTGAACAAATGAATGAAGG - Intergenic
1017231853 6:152081376-152081398 CTGGGTAAATAACAAAATGAAGG + Intronic
1017279898 6:152611898-152611920 CTGGGTAAATAACAAAATGAAGG + Intronic
1017303155 6:152885541-152885563 CTGGGTAAATAACAAAATGAAGG + Intergenic
1017411779 6:154175073-154175095 CTGGGTAAATAACAAAATGAAGG + Intronic
1018075779 6:160211962-160211984 CTGGGTAAACAATGAAATGAAGG - Intronic
1019086524 6:169482936-169482958 TTGGGTAAATAATAGAATGAAGG + Intronic
1019238772 6:170647115-170647137 CTGGGTAAATAAAGATATTAAGG - Intergenic
1020048823 7:5066836-5066858 CTGGGTAAACAAAACAAAGATGG + Exonic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020609338 7:10375440-10375462 CTGGGTAAATAACAAAATGAAGG + Intergenic
1020659248 7:10963321-10963343 CTGGGTAAATAACAAAATGAAGG - Intergenic
1020833776 7:13124069-13124091 CTGGGTAAATAACAAAATGATGG - Intergenic
1020928007 7:14356839-14356861 CTGGGTAAATAATAAAATGAAGG - Intronic
1021166718 7:17351699-17351721 CTGGGTAAATAACAAAATGAAGG - Intergenic
1021238475 7:18172691-18172713 CTGGGTAAATAACAAAATGAAGG - Intronic
1021307440 7:19048640-19048662 CTGGGTAAATAATAAAATGAAGG + Intronic
1021502023 7:21342592-21342614 CTGGGTAAATAACAAAATGAAGG - Intergenic
1021524717 7:21574520-21574542 GAGGGAAAACAAAAGTATGCAGG - Intronic
1022187542 7:27984854-27984876 CTGGGTACACAACAAAATGAAGG + Intronic
1022628299 7:32061129-32061151 CTGGATAAACAACAGTTTAATGG + Intronic
1023110325 7:36804366-36804388 CTGGGCAAAAAAAAGAATGTAGG - Intergenic
1023539870 7:41253525-41253547 TTTGGGAAACAAAAGTCTGAGGG + Intergenic
1023625272 7:42109162-42109184 CTGGGAAAACAAAAGATTGTAGG - Intronic
1024034110 7:45492693-45492715 CTGGGTAAATAAAAAAATTAAGG - Intergenic
1024372634 7:48604471-48604493 CTGGGTAAATAACAAAATGAAGG - Intronic
1026402190 7:70025754-70025776 CTTAGTAAAAAAAAGTATGCAGG - Intronic
1026488434 7:70841074-70841096 CTGGGTAAATAACAAAATGAAGG + Intergenic
1027702041 7:81481313-81481335 CTGGGTAAATAACAAAATGAAGG + Intergenic
1027777939 7:82489989-82490011 CTGGGTAAATAACAAAATGAAGG - Intergenic
1028278887 7:88895701-88895723 CTCAGTAAAGAAAACTATGAAGG + Intronic
1028369319 7:90072853-90072875 CTGGGTAAATAACAAAATGAAGG + Intergenic
1028786238 7:94797277-94797299 CTGGGTAAATAACAAAATGAAGG + Intergenic
1028802722 7:94985073-94985095 CTGGGTAAATAACAAAATGAAGG - Intronic
1028805721 7:95024023-95024045 CTGGGTAAACAAAGAAATTAGGG - Intronic
1029006270 7:97213279-97213301 CTGGGTAAATAACAAAATGAAGG - Intergenic
1029053097 7:97710253-97710275 CTGGGTAAATAACAAAATGAAGG - Intergenic
1029844922 7:103403113-103403135 CTGGGTAAATAACAATATTAAGG - Intronic
1031366242 7:120903602-120903624 CTGGGTAAATAACAAAATGAAGG + Intergenic
1031391795 7:121224199-121224221 CTGGGTAAATAACAAAATGAAGG - Intronic
1031622633 7:123953512-123953534 TTGGGTAAACCAAAGTGTGTAGG + Exonic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1031902374 7:127425688-127425710 CTGGGTAAATAACAAAATGAAGG - Intronic
1032269936 7:130395359-130395381 CTGGGGAAAAAAAAGTATCGTGG + Exonic
1032603781 7:133327678-133327700 CTGGGTAAATAACAAAATGAAGG - Intronic
1032659454 7:133967568-133967590 CTGGGTAAATAACAAAATGAAGG - Intronic
1032764604 7:134978890-134978912 CTGGGTAAATAACAAAATGAAGG + Intergenic
1033856168 7:145563666-145563688 CTGGGTACACAACAAAATGAAGG + Intergenic
1034394458 7:150810456-150810478 CTGGGTAAATAACAAAATGAAGG + Intergenic
1035508997 8:159492-159514 CTGGGTAAATAAAGATATTAAGG + Intergenic
1035700470 8:1635268-1635290 CTGGGAAAACAAAATTATGGAGG + Intronic
1035873571 8:3162634-3162656 CTTGAAAAACAAAAGTAAGAGGG - Intronic
1037316979 8:17608428-17608450 CTGGGTAAATAAACGCATGAGGG - Intronic
1037664815 8:20959108-20959130 CTGGGTAAATAACAAAATGAAGG + Intergenic
1037689918 8:21172935-21172957 CTGGGTGCACAAAAGTTAGAAGG - Intergenic
1038876994 8:31561629-31561651 CTGGGTAAACAACACAATTAAGG + Intergenic
1039676501 8:39673863-39673885 CTGGGTAAATAACAAAATGAAGG - Intronic
1039939114 8:42073989-42074011 CTGGGTAAAGCCATGTATGAAGG - Intergenic
1040411051 8:47154614-47154636 CTGGGTAAATAACAAAATGAAGG + Intergenic
1040431480 8:47347187-47347209 CTGGGTAAATAACAAAATGAAGG - Intronic
1040784055 8:51144667-51144689 CTGGGTAAATAATAAAATGAAGG - Intergenic
1041054763 8:53973153-53973175 ATGGGAAAACAAAAGTCAGAAGG + Intronic
1041583687 8:59492371-59492393 CTGGGTAAATAACAACATGAAGG - Intergenic
1041750143 8:61252157-61252179 CTGGGTAAATAACAAAATGAAGG - Intronic
1041843731 8:62302755-62302777 CTTAGTAAACAAAAGCATAAGGG + Intronic
1042195863 8:66231409-66231431 CTGGGTAAATAACATAATGAAGG + Intergenic
1043081403 8:75769804-75769826 CTGGGTAAATAACAAAATGATGG - Intergenic
1043088932 8:75873617-75873639 CTGGGTAAACAACAAAATGAAGG - Intergenic
1043165603 8:76899316-76899338 CTGGGTAAATAACAAAATGAAGG - Intergenic
1043244163 8:77976979-77977001 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1043287500 8:78552024-78552046 CTGGTTAAAAAAAATTATAAAGG + Intronic
1043604880 8:81988320-81988342 CTGGGTAAATAACAAAATGAAGG - Intergenic
1043725413 8:83604623-83604645 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1045415031 8:101957709-101957731 CTGGTTAAACAAGAGCCTGAAGG + Intronic
1045475610 8:102549912-102549934 CTGGGGAAACAATATCATGAAGG + Intergenic
1045545022 8:103120907-103120929 TTGGGTAAACAATTGCATGATGG + Intergenic
1045702187 8:104879959-104879981 CTGGGGAAATAAAAGTGAGATGG - Intronic
1046162814 8:110389429-110389451 CTGGGTACACAACATAATGAAGG - Intergenic
1046240757 8:111487934-111487956 CTGGGTAAACAATAAAATTAAGG - Intergenic
1046439667 8:114241425-114241447 CTGGGTAATGGAAAGTATTAGGG - Intergenic
1047129605 8:122004153-122004175 CTGGGTAAATAACAAAATGAAGG + Intergenic
1047931809 8:129735557-129735579 CTGGGTAAACAACAAAATGAAGG + Intergenic
1048134774 8:131737960-131737982 GTGAATAAACAAAAGTTTGAGGG + Intergenic
1049608873 8:143543191-143543213 ATGGTTACACAAAATTATGACGG + Intergenic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1050590807 9:7158581-7158603 CTGGGTAAACAACGAAATGAAGG - Intergenic
1050699910 9:8327269-8327291 CTGGGTAAATAACAGAATGAAGG - Intronic
1050700611 9:8334440-8334462 CTGGGTAAATAACAGAATGAAGG + Intronic
1050976423 9:11944352-11944374 CTGGGTACATAAAAAAATGAAGG + Intergenic
1051309084 9:15749723-15749745 CTGGGTAAATAACAAAATGAAGG + Intronic
1051549003 9:18308094-18308116 CTGGGTAAATAACAAAATGAAGG + Intergenic
1051670193 9:19502369-19502391 CTGGGTAAATAACAAAATGAAGG - Intergenic
1052888247 9:33670233-33670255 CTGGGTAAACAACAAAATGAAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1055013187 9:71589501-71589523 CTGGGTAAACAGTAATATAAGGG - Intergenic
1055310325 9:74972851-74972873 CTGGGTAAATAACAAAATGAAGG - Intergenic
1055345299 9:75329355-75329377 TTGGGTAAACAACAGAATTAAGG + Intergenic
1056016076 9:82389412-82389434 CTGGGTAAATAACAAAATGAAGG - Intergenic
1056302354 9:85255388-85255410 CTGGGTAAACAAGAAAATTAAGG - Intergenic
1056668338 9:88600216-88600238 CTGGGTAAATAACAAAATGAAGG + Intergenic
1057406853 9:94779849-94779871 CTGTGTAAACAAAAGTTTACAGG - Intronic
1060269203 9:122129030-122129052 CTTAGTAAACAATAGGATGAAGG + Intergenic
1060378833 9:123145089-123145111 CAAGGTAAATAAAAGTAAGAAGG + Intronic
1062758975 9:138327407-138327429 CTGGGTAAATAAAGATATTAAGG - Intergenic
1203573588 Un_KI270744v1:155571-155593 CTGGGTACATAACAGAATGAAGG + Intergenic
1186927943 X:14355915-14355937 TTGGGGAAAAGAAAGTATGAAGG - Intergenic
1188644614 X:32550389-32550411 CTGGGTAAACAATAAAATTAAGG + Intronic
1189234235 X:39475458-39475480 CTGTTTAAACAAGAGTAGGAGGG - Intergenic
1189602095 X:42637901-42637923 TTGGGAAAAAAAAATTATGATGG + Intergenic
1189878290 X:45460663-45460685 TTGGGTAAACAAAGGAATTAAGG - Intergenic
1189978144 X:46483301-46483323 CTGGGTAAATAACAAAATGAAGG - Intronic
1191003910 X:55689783-55689805 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191088450 X:56594879-56594901 CTGGGTAAACAACAACATTAAGG - Intergenic
1191154278 X:57254675-57254697 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1191198169 X:57747028-57747050 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191208367 X:57857878-57857900 CTGGGTAAAAAACAAAATGAAGG + Intergenic
1191635384 X:63370311-63370333 CTGGGTACACAACAAAATGAAGG + Intergenic
1191740409 X:64431990-64432012 TTGTGTAGACAAAGGTATGAGGG - Intergenic
1191821035 X:65308889-65308911 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191824455 X:65349267-65349289 CTGGGTAAATAACAAAATGAAGG + Intergenic
1191907124 X:66105541-66105563 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1191996390 X:67100211-67100233 CTGGGTAAATATAAGGGTGAGGG + Intergenic
1192133949 X:68579518-68579540 CTGGGTAAATAACAAAATGAAGG - Intergenic
1192393910 X:70758520-70758542 CTGGGTAAATAACAAAATGAAGG + Intronic
1192396159 X:70783231-70783253 CTGGGTAAATAACAAAATGAAGG + Intronic
1192678559 X:73226755-73226777 CTGGGTAAATAACAAAATGAAGG + Intergenic
1192754882 X:74037183-74037205 CTGGGTACACAACAAAATGAAGG - Intergenic
1192937757 X:75878893-75878915 CTGGGTAAATAACAAAATGAAGG - Intergenic
1193402865 X:81066551-81066573 CTGGGTAAATAACAAAATGAAGG + Intergenic
1193445924 X:81602434-81602456 CTGGGTAAATAACAAAATGAAGG - Intergenic
1193733599 X:85130887-85130909 CTGGGTAAATAACAAAATGAAGG - Intergenic
1193835519 X:86338468-86338490 CTGGGTAAACAACAAAATTAAGG + Intronic
1193907040 X:87256490-87256512 CTGGGTAAAAAACAAAATGAAGG + Intergenic
1195163069 X:102190214-102190236 CTGGGTAAATAACAAAATGAAGG - Intergenic
1195580011 X:106491054-106491076 CTGGGTAAATAACAAAATGAAGG - Intergenic
1195774536 X:108388955-108388977 CTGGGTAAACAACGAAATGAAGG - Intronic
1195846224 X:109231689-109231711 CTGGGTAAATAACAAAATGAAGG + Intergenic
1195988603 X:110659785-110659807 CTGGGTAAATAACAAAATGAAGG + Intergenic
1196094789 X:111787307-111787329 CTGGGTAAATAACAAAATGAAGG + Intronic
1196475085 X:116074456-116074478 CTGGGTAAACAATAAAATTAAGG + Intergenic
1196575115 X:117307934-117307956 CTGGGTAAATAACAAAATGAAGG + Intergenic
1196589146 X:117465431-117465453 CTGGGTAAATAACAAAATGAAGG - Intergenic
1197607672 X:128604464-128604486 TGGGGTAAACAAAATGATGAGGG - Intergenic
1198256490 X:134928433-134928455 CTCTGTATACAAAAGTATGATGG + Intergenic
1198585693 X:138118280-138118302 CTGTGTTAGCAAAAATATGAAGG - Intergenic
1198589164 X:138156950-138156972 CTGGGTGGACAAAAGACTGATGG + Intergenic
1199384030 X:147203189-147203211 CTGGGTAAATAACAAAATGAAGG + Intergenic
1199436888 X:147822299-147822321 CTGGGTAAATAACAAAATGAAGG + Intergenic
1199524640 X:148779083-148779105 CTGGGTAAATAACAATATCAAGG - Intronic
1200269488 X:154668661-154668683 CTGGGTAAATAACAAAATGAAGG - Intergenic
1200574339 Y:4869252-4869274 CTGGGTACACAACAAAATGAAGG + Intergenic
1200731751 Y:6750180-6750202 CTGGGTAAACAACAAAATTAAGG - Intergenic
1200732310 Y:6755897-6755919 CTGGGTAAACAATGAAATGAAGG - Intergenic
1201182419 Y:11361697-11361719 CTGGGTAAATAACAAGATGAAGG + Intergenic
1201392880 Y:13517657-13517679 CTGGGTAAATAATAAAATGAAGG - Intergenic
1201957675 Y:19644134-19644156 CTGGGTAAACAATGAAATGAAGG - Intergenic
1202044118 Y:20720139-20720161 CTGGGTAAATAACAAAATGAAGG + Intergenic
1202174908 Y:22088920-22088942 CTGGGTAAATAACAAAATGAAGG + Intronic
1202216454 Y:22497462-22497484 CTGGGTAAATAACAAAATGAAGG - Intronic
1202326734 Y:23698607-23698629 CTGGGTAAATAACAAAATGAAGG + Intergenic
1202544035 Y:25971446-25971468 CTGGGTAAATAACAAAATGAAGG - Intergenic