ID: 1020108318

View in Genome Browser
Species Human (GRCh38)
Location 7:5433192-5433214
Sequence AGAGCCTACAAGGGTCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020108311_1020108318 23 Left 1020108311 7:5433146-5433168 CCTCACTATAGCAGCTTAAAGAG 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1020108318 7:5433192-5433214 AGAGCCTACAAGGGTCAAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 77
1020108312_1020108318 -9 Left 1020108312 7:5433178-5433200 CCATCCCAAATCTAAGAGCCTAC 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1020108318 7:5433192-5433214 AGAGCCTACAAGGGTCAAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020108318 Original CRISPR AGAGCCTACAAGGGTCAAGT GGG Intronic
901247720 1:7745883-7745905 AGAGCCAACAGGGCTCAAGCTGG - Exonic
905921449 1:41722105-41722127 AGACCCTACTAGGGTCAGGTGGG - Intronic
906131987 1:43465755-43465777 AGGGCCTACAAGGGTGATGGGGG + Intergenic
907496285 1:54846981-54847003 AGGAGCTCCAAGGGTCAAGTTGG - Intergenic
912214678 1:107594830-107594852 AGAGCCTAGGAGGGAGAAGTGGG - Intronic
915602752 1:156932501-156932523 AGTGCATCCAAGGGTCCAGTGGG + Exonic
919733993 1:200933303-200933325 AGAGATTACAAGCATCAAGTGGG - Intergenic
921305189 1:213789243-213789265 AGAGCCTAAAAGGGCCAGGATGG + Intergenic
1070689188 10:78512066-78512088 AGAGCCTGCCAGGCTGAAGTAGG + Intergenic
1070828937 10:79407016-79407038 AGAGACCAGAAGGGTCAAGGAGG - Intronic
1072660955 10:97363258-97363280 TGAACCAACAAGGGTGAAGTGGG - Intronic
1073080769 10:100859297-100859319 AGAGCCTAAAAGGGTGAAGAAGG - Intergenic
1074278076 10:112023878-112023900 AGAGCCTGCTAGGGTCAGCTAGG + Intergenic
1075948257 10:126455952-126455974 AGAACCTGAAAGGTTCAAGTGGG - Intronic
1084608270 11:70185171-70185193 AGAGCCTACTTGGTTGAAGTCGG - Intronic
1085127221 11:74010192-74010214 AAAGCCTCCAAGTGTCATGTTGG - Intergenic
1089168264 11:116494429-116494451 AGCGCCTACAAGGGATAAGGTGG + Intergenic
1090044757 11:123321326-123321348 AGACCATCCAAGGGCCAAGTAGG + Intergenic
1091013836 11:132031348-132031370 ATAGACTCCAAGGGTCAAGTTGG + Intronic
1091142703 11:133249534-133249556 AGAGGATTCAAGGGTCCAGTTGG - Intronic
1091341852 11:134822022-134822044 AGAACCTAGAAGGGTGAAGGAGG - Intergenic
1100354289 12:93814402-93814424 AGAGTACACAAGGTTCAAGTGGG + Intronic
1101740814 12:107498607-107498629 AAAGCCCACAACGGTCAATTAGG + Intronic
1120047553 14:79825432-79825454 AGATCCTACTAGGGTCAACGTGG - Intronic
1120102915 14:80465310-80465332 AGAGCCTAAAAAGGTGAAGGAGG + Intergenic
1120186266 14:81396476-81396498 AGTGCTTACAGAGGTCAAGTAGG + Intronic
1120378731 14:83745610-83745632 AGAGCCAAAAAAGGTGAAGTTGG - Intergenic
1122256876 14:100484867-100484889 ACAGCCTCCAAGGGGCAAGGGGG - Intronic
1131220733 15:90581978-90582000 GGAGGCCACAAGGGTCAGGTAGG - Intronic
1133657461 16:7879790-7879812 AAAGCCTCCAAGAGGCAAGTAGG + Intergenic
1134639413 16:15817918-15817940 AGAACCTACCAGGGTCAGGATGG - Intronic
1135576527 16:23590171-23590193 AGTACCTACAAGGGCCAGGTGGG + Intronic
1138395383 16:56700298-56700320 AGAGGTTACAAGGGGCTAGTGGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140573265 16:76134225-76134247 ATAGCCTACACTAGTCAAGTGGG - Intergenic
1144606911 17:16674774-16674796 AAACCCCACAAAGGTCAAGTAGG + Intergenic
1150379507 17:64709574-64709596 AGTTCCAACAAGGGTCAGGTTGG + Intergenic
1155159037 18:23181054-23181076 AGAGTCTATAAGGTTGAAGTGGG + Intronic
1155868682 18:30998268-30998290 AGAGCCTACAAGTATCTAGATGG + Intronic
1157990898 18:52495077-52495099 AGAGCCTACTAAGATCAACTGGG + Intronic
926057264 2:9781290-9781312 GGAGTCTACAAGGGTCAGGCAGG - Intergenic
927400250 2:22703185-22703207 AGAGCCCACAAGGGTCAAGAAGG - Intergenic
928439653 2:31281727-31281749 AAAGCCTACAAGAGTCAGGTGGG - Intergenic
929124401 2:38510164-38510186 AGAGCCCGGAAGGGTCATGTAGG - Intergenic
937890081 2:126931851-126931873 AGGGCCTGTAAAGGTCAAGTGGG + Intergenic
938141763 2:128800221-128800243 AGAGCCTCCATGGGTCTGGTTGG + Intergenic
938180347 2:129176643-129176665 AGACCCTACAAGAATGAAGTTGG - Intergenic
938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG + Intergenic
946197548 2:218044087-218044109 TGAGCCTGCAAGGGTCAGGGAGG + Intronic
946604718 2:221390909-221390931 AGAGTTTACAAGGGTTAAGCAGG + Intergenic
1172425217 20:34851384-34851406 AGAGACCACAAGGGGCAGGTGGG + Intronic
1172934549 20:38610305-38610327 GGTGCCTACAAGGGTTAAGTGGG + Intronic
1180920038 22:19516925-19516947 ATAGCCTCAAAGGGTCAGGTGGG - Intronic
1183745873 22:39691389-39691411 AGAGCCTGCAAGTGCCAAGAAGG + Intergenic
1183998477 22:41654375-41654397 AGAGCATAAAAGGGTGAATTTGG - Intronic
950207790 3:11093678-11093700 AGAGACTAAAAGGGTCCATTAGG + Intergenic
952073283 3:29665634-29665656 AGAGCCTAAAAGGGCAATGTTGG - Intronic
963487953 3:145960210-145960232 AGACCCTACAAGGATGCAGTTGG + Intergenic
967540433 3:190661004-190661026 AGAGCCTACAAGGGTAAAAGAGG - Intergenic
972098150 4:35375730-35375752 AGAGACTACAAGGGACAGTTAGG + Intergenic
972866491 4:43239732-43239754 AGAAGCTAGAAAGGTCAAGTAGG + Intergenic
975725051 4:77283799-77283821 GGAGCCTTCCAGGGTCAAATGGG + Intronic
986316936 5:6595661-6595683 GGAGCTTACAGGGGTCATGTGGG - Intergenic
990803008 5:59626924-59626946 AGAGCCAACAAAGGCAAAGTAGG - Intronic
992691727 5:79247412-79247434 TGAGACTACAAGGTTGAAGTGGG - Intronic
1000503077 5:162077180-162077202 AGAGGCTACCAGGGGCAAGCAGG - Intronic
1001098208 5:168792558-168792580 AGTGCCTACAAAGGTCATGCAGG + Intronic
1002347857 5:178560521-178560543 AGAGCCTGCCAGGGTCAATGTGG + Intronic
1005781041 6:29192499-29192521 AAAGCCTACCATGATCAAGTAGG + Intergenic
1020108318 7:5433192-5433214 AGAGCCTACAAGGGTCAAGTGGG + Intronic
1040342660 8:46448741-46448763 AGGGCCCACAAGGGTGGAGTTGG - Intergenic
1044988893 8:97778008-97778030 ACAGCCAACAGGGCTCAAGTAGG - Intronic
1045285198 8:100784705-100784727 AGAGCCTACAAAGATCAGGAAGG + Intergenic
1049101861 8:140585604-140585626 AGAGCCCAAAAGTGTCAAGGCGG + Intronic
1054855717 9:69897716-69897738 AGAGCATACAAGGGGCAATGGGG + Intronic
1058013457 9:100003901-100003923 AGGGCCTACTAGGGTGAACTTGG + Intronic
1059494015 9:114694564-114694586 AGAGGCTACAAGGGATAAATAGG + Intergenic
1059512451 9:114862138-114862160 ATAGCCCACAAAGGACAAGTGGG + Intergenic
1061975627 9:134067048-134067070 AGAGCCCACCAGGGCCATGTGGG + Intronic
1062080069 9:134619064-134619086 AGAGCCTACCAGGGTGGAGAAGG - Intergenic
1187196222 X:17087397-17087419 AGAGACTAGAAGATTCAAGTTGG + Intronic
1188452122 X:30318419-30318441 AGAGTCTACAAGGTTCAAGGTGG + Intergenic
1189880583 X:45487273-45487295 TGGGCCTCCAAGGGTCCAGTCGG - Intergenic
1190286982 X:48967884-48967906 AGAGCCAGCAATGGCCAAGTTGG - Intronic
1194938337 X:99978970-99978992 AGAGCCTAGAGGGGTAAAGAGGG - Intergenic
1198017703 X:132628835-132628857 GCAGCCTACCAGGGTCAGGTCGG + Exonic