ID: 1020111641

View in Genome Browser
Species Human (GRCh38)
Location 7:5451203-5451225
Sequence GACTCCACCCCCACTGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020111638_1020111641 -7 Left 1020111638 7:5451187-5451209 CCATCTCAGACACAACGACTCCA 0: 1
1: 0
2: 2
3: 13
4: 142
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1020111634_1020111641 13 Left 1020111634 7:5451167-5451189 CCCGCAGGCCTTCAAGGTTCCCA 0: 1
1: 0
2: 0
3: 14
4: 184
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1020111632_1020111641 17 Left 1020111632 7:5451163-5451185 CCTCCCCGCAGGCCTTCAAGGTT 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1020111635_1020111641 12 Left 1020111635 7:5451168-5451190 CCGCAGGCCTTCAAGGTTCCCAT 0: 1
1: 0
2: 0
3: 7
4: 205
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1020111636_1020111641 5 Left 1020111636 7:5451175-5451197 CCTTCAAGGTTCCCATCTCAGAC 0: 1
1: 0
2: 3
3: 12
4: 174
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1020111637_1020111641 -6 Left 1020111637 7:5451186-5451208 CCCATCTCAGACACAACGACTCC 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1020111633_1020111641 14 Left 1020111633 7:5451166-5451188 CCCCGCAGGCCTTCAAGGTTCCC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG 0: 1
1: 0
2: 3
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020111641 Original CRISPR GACTCCACCCCCACTGTGTG GGG Intronic
902442124 1:16437518-16437540 GACTCTCCCCAGACTGTGTGGGG + Intergenic
904326773 1:29731636-29731658 GACTCCATGCCCAGTTTGTGGGG + Intergenic
906779333 1:48558447-48558469 GACTCCACTCAGACTGTGGGTGG + Intronic
907334088 1:53689096-53689118 CACTCCACCCTCACAGGGTGGGG + Intronic
914734995 1:150407579-150407601 TACTCCTCCACCACTATGTGAGG - Intronic
914758389 1:150579477-150579499 GACTCAACCTCTACTGTGGGGGG - Exonic
915953673 1:160206198-160206220 CACCACACCCCCACTCTGTGGGG + Intronic
917752631 1:178067461-178067483 GACTCAACACCCACTGAGAGGGG - Intergenic
920746732 1:208635891-208635913 TACTCCATCCCCACTGTGTTGGG + Intergenic
922726609 1:227925760-227925782 GACTCGACCCCCACAGTTTCAGG + Intronic
922759996 1:228122638-228122660 GACTACCCCACCACTGAGTGGGG + Intergenic
1065130553 10:22615879-22615901 GGCTCCAGCCACTCTGTGTGGGG - Intronic
1067227355 10:44384822-44384844 GCCTCCACCCCCACTGTGTCGGG + Intronic
1067406165 10:46025332-46025354 AAATCCACCCTCAGTGTGTGTGG - Intronic
1073276422 10:102315503-102315525 CCCTCCAGCCCCACTGTCTGTGG - Intronic
1074163555 10:110855134-110855156 GATGCCACACCCACTGTGGGAGG - Intergenic
1074380190 10:112973182-112973204 GAATCCACCCCCAGGGTGTCAGG + Intronic
1076014419 10:127015936-127015958 GGCTCCACCTCCCCTGGGTGAGG + Intronic
1077522789 11:3046208-3046230 GCCTCCATCCACACTGTGAGAGG - Intronic
1077862323 11:6194124-6194146 CTCTCCTCCCACACTGTGTGAGG - Intergenic
1077896850 11:6459374-6459396 CTCTTCACCCCCTCTGTGTGGGG + Intronic
1078406863 11:11077730-11077752 CACTGCACCCCCACTGTGCTTGG + Intergenic
1078646064 11:13142241-13142263 GACTCCACCCCCACCTCGGGCGG + Intergenic
1082771643 11:57212340-57212362 GAATCCATACCCATTGTGTGTGG - Intergenic
1083871109 11:65489092-65489114 ACCCCCACCCCCACTGTTTGTGG - Intergenic
1083961271 11:66016243-66016265 GACTCCACCTCCCCTCAGTGGGG + Intergenic
1084226465 11:67717678-67717700 GCCTCCAGCCCTACAGTGTGAGG - Intergenic
1085096118 11:73761547-73761569 GACCCCACCCACACTTTTTGGGG - Intergenic
1085635882 11:78159235-78159257 CACGCCATCCCAACTGTGTGTGG + Intergenic
1090134708 11:124185321-124185343 ATCTCCAGCCCCTCTGTGTGTGG - Exonic
1090187988 11:124750827-124750849 GTGGCCACCCCCACTGTGGGGGG + Exonic
1092033297 12:5308082-5308104 GCCTCCACACCCATTGTGAGGGG + Intergenic
1094016197 12:25866976-25866998 GTCTCCACCAACACTGTGTGGGG - Intergenic
1094061361 12:26318012-26318034 GATTCAACTCCCACTGTGTATGG + Intergenic
1096671295 12:53199687-53199709 AACCCCATCCCCACTATGTGAGG + Intronic
1096745988 12:53727242-53727264 GAAGCCACCCCCGCTGTTTGGGG - Intronic
1097166116 12:57087564-57087586 CCCACCACCCCCACTGTGTTTGG + Intronic
1098361412 12:69657893-69657915 GACCCACCCTCCACTGTGTGAGG + Intronic
1099548948 12:84018948-84018970 GTCTCCACCCCCATTGACTGGGG - Intergenic
1104781694 12:131425573-131425595 GTCTCTACCCTCACTGGGTGTGG - Intergenic
1106951481 13:34889353-34889375 GACTACAGCTCCACTGTGAGTGG - Intergenic
1110571124 13:77004598-77004620 GACTCCAACCCCAGTTTGTGGGG - Intronic
1111044318 13:82795243-82795265 GACTGAATCCCCAATGTGTGGGG + Intergenic
1113314801 13:109167220-109167242 GACTCCCCACCCATTGAGTGTGG - Intronic
1113896125 13:113765684-113765706 GCCCCCTCCCCCACTGGGTGTGG + Intronic
1118059833 14:62123516-62123538 GCCTCCACCCCTTCTGTCTGTGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119680087 14:76585615-76585637 CTCTCCCCTCCCACTGTGTGAGG - Intergenic
1121236224 14:92393019-92393041 GACACCTCTTCCACTGTGTGAGG + Intronic
1121467788 14:94127208-94127230 GACCACACCCTCACTGTGTGAGG - Intergenic
1121728309 14:96168877-96168899 GTCTTCATCCCCACTGTATGTGG + Intergenic
1127405442 15:58640100-58640122 CACTCCACCCCCACTGTAATGGG + Intronic
1130105220 15:80923709-80923731 GACTCCACATCCACAGTGAGAGG + Intronic
1132462787 16:63613-63635 GACGCCACCCCCACTCTACGTGG - Exonic
1132897257 16:2234939-2234961 AACTCCACCAACACTGTGTGCGG - Exonic
1133040538 16:3058112-3058134 GTCTCCTCCCCCAGGGTGTGTGG - Intronic
1135068969 16:19335662-19335684 GACTCCTCCAGCACTCTGTGTGG + Intergenic
1138853289 16:60656342-60656364 GACACCACCTCCAATGTTTGGGG + Intergenic
1139340773 16:66266730-66266752 GACCCCACCCCCACCCCGTGAGG + Intergenic
1139364626 16:66426277-66426299 GATTGCACCCCTACTGTGTTGGG - Intergenic
1141581964 16:85005527-85005549 GACTCCACCCTAACTGGCTGTGG - Intronic
1141698711 16:85632745-85632767 GACACCAGCCCCACCATGTGTGG + Intronic
1142281098 16:89147955-89147977 GCCTGCACCCCCACTGTATCTGG - Intronic
1146696054 17:34909740-34909762 AACTCTGCCCCCACTGGGTGTGG - Intergenic
1150809622 17:68346461-68346483 GACGCCACCCCCATGGTGAGGGG - Intronic
1151344451 17:73493029-73493051 GTCTCCAGCCCAGCTGTGTGCGG + Intronic
1152329976 17:79667112-79667134 CACTCCACCCCCACTGCATGAGG + Intergenic
1152769910 17:82161235-82161257 ACCTCCACCAGCACTGTGTGAGG - Intronic
1157157574 18:45282644-45282666 GACACCACCCTCGCTGTGTGAGG + Intronic
1163766359 19:19165544-19165566 CACTCCACCCCAGATGTGTGGGG - Intronic
1164769557 19:30797736-30797758 CAATTCACCCCCACTGTGTGGGG + Intergenic
1165442722 19:35839541-35839563 CACTCCAGCCCCACGGAGTGTGG + Exonic
1166268881 19:41701472-41701494 GACTCAACCCCCACTGGGAAAGG + Intronic
1166707969 19:44919051-44919073 ATCTCCATCCCCACTGTCTGTGG - Intronic
1166710022 19:44930878-44930900 ATCTCCATCCCCACTGTCTGTGG - Intergenic
1167351152 19:48975552-48975574 GTCTCCACCCCCATTGACTGGGG - Intronic
1167426704 19:49433342-49433364 GCCTCCACCCCCAAAGTGTTGGG + Intronic
1168192710 19:54751387-54751409 AATTTCACCCCCACTGTGGGAGG - Intronic
1168197049 19:54782660-54782682 AATTTCACCCCCACTGTGGGAGG - Intronic
1168702887 19:58452022-58452044 GACTGCGCCCCCACGGAGTGAGG + Intronic
924987631 2:286935-286957 TTCTCCCCACCCACTGTGTGCGG - Intronic
926088078 2:10032575-10032597 GCCTCCAGCCCCACGGTGTGAGG + Intergenic
926172032 2:10558593-10558615 GACTCCACCTTCACAGTGTGAGG + Intergenic
927291684 2:21410748-21410770 GACACCACCCCCACTCTGGAGGG - Intergenic
932338924 2:70947545-70947567 GACTCCATCCCCAATGTCTGTGG + Intronic
933889464 2:86753813-86753835 GGCTACACCACCACTTTGTGTGG + Intronic
936849663 2:116880421-116880443 GAGTACACCAGCACTGTGTGAGG - Intergenic
938135714 2:128754965-128754987 GACTCCACCCAGACTGACTGTGG - Intergenic
940024840 2:149194907-149194929 GATTCAACACACACTGTGTGGGG - Intronic
946073915 2:217057883-217057905 GACCCTGCCGCCACTGTGTGGGG - Intergenic
948718891 2:239883663-239883685 GACCCCAACCCCACTGAGGGTGG + Intergenic
949035526 2:241814250-241814272 CACTCCACCCCAAATGTCTGTGG - Intronic
1168846181 20:946199-946221 GACTCCAGCCCCCATGTGAGAGG + Intergenic
1171084333 20:22223529-22223551 GACTCTACCCACTCTCTGTGTGG + Intergenic
1173150405 20:40562155-40562177 GACCCCACCCCCAGAGAGTGAGG - Intergenic
1174350708 20:49965596-49965618 GACTCCACACAGTCTGTGTGGGG - Intergenic
1174396618 20:50250690-50250712 GACCCCACCCCCACTGTGTCAGG - Intergenic
1181460895 22:23085376-23085398 GAATCCAGCCCCACTGTGTGTGG - Intronic
1182795281 22:32987181-32987203 CACTCCACCCCCAGTGGGGGTGG - Intronic
1184094307 22:42308343-42308365 GTCTCCACCCCTAGTGTTTGTGG - Intronic
1184141087 22:42577714-42577736 GAGCCCATCCTCACTGTGTGTGG - Intergenic
1184449935 22:44576800-44576822 GACTGCACCCCCAGTGAGAGAGG - Intergenic
1184515320 22:44958276-44958298 GACTAGACCCTCACTGTGTAGGG - Intronic
1185157012 22:49199195-49199217 GACTCCACGCCCAGTCTGCGGGG - Intergenic
1185227197 22:49659848-49659870 GCCTGCACCCCCACTGCCTGCGG - Intergenic
951078003 3:18420678-18420700 CACTCCACCCCCACACAGTGTGG + Intronic
951906422 3:27712338-27712360 TCCTCCACTCCAACTGTGTGGGG + Intergenic
952640509 3:35588672-35588694 GACTTCATCCCCTCTTTGTGTGG - Intergenic
954292096 3:49655134-49655156 ATCTGCACCACCACTGTGTGTGG - Exonic
954380924 3:50218583-50218605 GACTCCACCCCGTCTGTGGCAGG - Exonic
957978773 3:87481046-87481068 GACGCCATCTCCACTGAGTGGGG + Intergenic
958563264 3:95776108-95776130 GAATCCCTCCCCACTTTGTGTGG - Intergenic
961365403 3:126396226-126396248 GACTCCAGCCCCCCAGTTTGTGG - Intronic
962037091 3:131663600-131663622 GACTCCAGGACCACTGAGTGTGG + Intronic
963903527 3:150755132-150755154 AACTCCAGCCCCACTGTGACTGG - Intronic
964012638 3:151909400-151909422 CTGTCCACCCCAACTGTGTGAGG - Intergenic
964896907 3:161608861-161608883 TACTCCACAGCCAGTGTGTGAGG - Intergenic
968554410 4:1239948-1239970 GCCTCCCTCCCCGCTGTGTGTGG + Intronic
969735524 4:8987204-8987226 GACTCCAGCCCTGCAGTGTGAGG + Intergenic
971356995 4:25904023-25904045 GGTGCCACCCACACTGTGTGAGG + Intronic
977261611 4:94803392-94803414 GACTCCACCCCCAGTGTTAGGGG + Intronic
979004041 4:115265897-115265919 GCCTCCACTGACACTGTGTGGGG + Intergenic
980216761 4:129861968-129861990 GACTCCCCATACACTGTGTGGGG + Intergenic
985846577 5:2354072-2354094 GACTCCAGCCCCTTGGTGTGGGG + Intergenic
987544016 5:19288979-19289001 GACTACACTCCCAGTGTGTCCGG - Intergenic
988657722 5:33230630-33230652 GACTCCACCGCCACAATGAGAGG - Intergenic
997025223 5:130052311-130052333 AACCACACCCCCACTGTGGGGGG - Intronic
997580257 5:135012516-135012538 CACCCCTCCCCCTCTGTGTGAGG - Intergenic
998040544 5:138948525-138948547 GGCTCTGCCCCCACTGTGCGCGG + Intronic
1002426719 5:179181022-179181044 GCCTCCACCCCCTCGGAGTGAGG - Intronic
1003425164 6:5994377-5994399 CACTCCACCCCCACCGGGTGAGG - Intergenic
1005841711 6:29748342-29748364 GACTCCAACCCCTCAGCGTGAGG + Intergenic
1008692175 6:53991969-53991991 GACAACACTCCTACTGTGTGAGG - Intronic
1010229140 6:73520178-73520200 GTCTCCACCCACTCAGTGTGGGG + Exonic
1011259951 6:85460546-85460568 GATTCCATCCACATTGTGTGTGG - Intronic
1011659391 6:89581406-89581428 TACTCCACCAGCAGTGTGTGAGG + Intronic
1014042837 6:116849828-116849850 GACTCCACTCTCAGTGTGGGTGG + Intergenic
1014164963 6:118213388-118213410 TACTCCACCAGCACTGTGTATGG - Intronic
1015177356 6:130324885-130324907 GACTGCAGCCTCACAGTGTGAGG - Intronic
1015606267 6:134957693-134957715 CACTCCACCCCTCATGTGTGGGG - Intergenic
1016633217 6:146256419-146256441 CACTCCTCCCCCAGTGTGTCTGG + Intronic
1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG + Intergenic
1017007539 6:150038457-150038479 CCCTCCACCCTCACTGTGTTTGG + Intergenic
1018746174 6:166764136-166764158 GACTCCACTCCCACTGGGGAGGG + Intronic
1020111641 7:5451203-5451225 GACTCCACCCCCACTGTGTGGGG + Intronic
1020310203 7:6861425-6861447 GACTCCAGCCCTGCAGTGTGAGG - Intergenic
1023405239 7:39826760-39826782 GACTGCACCCCCAACTTGTGAGG + Intergenic
1034679651 7:152918981-152919003 GCCTCCACCCCCACTCCGGGTGG - Intergenic
1034716072 7:153243433-153243455 GCCTCCACCCCCATAGTTTGGGG + Intergenic
1037671591 8:21019846-21019868 GATTCCACCCCCACCGTCTCAGG - Intergenic
1039739861 8:40372770-40372792 TACTCCACCCCCCCGATGTGTGG + Intergenic
1042175197 8:66031762-66031784 CACCCCACCCTCACTGTGAGTGG - Intronic
1045338839 8:101233637-101233659 TCCTCCACCCCCAGTGTCTGTGG - Intergenic
1051122693 9:13769151-13769173 GTGTCCACCCACACTGGGTGAGG - Intergenic
1056805374 9:89724799-89724821 GACTCCACTTCCACAGTCTGAGG - Intergenic
1056991861 9:91420982-91421004 GCCTCCACCCCCAATTTCTGTGG + Intronic
1058755138 9:108076825-108076847 GCCTCCAGCCTCAGTGTGTGAGG - Intergenic
1060927556 9:127465622-127465644 CACTCAACACCCACCGTGTGAGG + Intronic
1061991107 9:134159242-134159264 TGCTCCGCCCTCACTGTGTGTGG - Exonic
1186503435 X:10070926-10070948 GATTCCACACCCACTCTGAGGGG + Intronic
1189462329 X:41252930-41252952 GGCTCCCCTCCCACTGTTTGTGG - Intergenic
1198116656 X:133550900-133550922 GATTCCATCCACACTGAGTGTGG - Intronic