ID: 1020112031

View in Genome Browser
Species Human (GRCh38)
Location 7:5452617-5452639
Sequence GGCCTCCCCGGGCTGATGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020112031_1020112041 13 Left 1020112031 7:5452617-5452639 CCACGCATCAGCCCGGGGAGGCC No data
Right 1020112041 7:5452653-5452675 GCCTCCAGGTCCTGCCCGCCAGG No data
1020112031_1020112038 -1 Left 1020112031 7:5452617-5452639 CCACGCATCAGCCCGGGGAGGCC No data
Right 1020112038 7:5452639-5452661 CCCAGGCCTGGTCAGCCTCCAGG 0: 1
1: 1
2: 5
3: 48
4: 455
1020112031_1020112045 26 Left 1020112031 7:5452617-5452639 CCACGCATCAGCCCGGGGAGGCC No data
Right 1020112045 7:5452666-5452688 GCCCGCCAGGCTCAGCTTCCCGG 0: 1
1: 1
2: 3
3: 26
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020112031 Original CRISPR GGCCTCCCCGGGCTGATGCG TGG (reversed) Intronic