ID: 1020112031 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:5452617-5452639 |
Sequence | GGCCTCCCCGGGCTGATGCG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1020112031_1020112041 | 13 | Left | 1020112031 | 7:5452617-5452639 | CCACGCATCAGCCCGGGGAGGCC | No data | ||
Right | 1020112041 | 7:5452653-5452675 | GCCTCCAGGTCCTGCCCGCCAGG | No data | ||||
1020112031_1020112038 | -1 | Left | 1020112031 | 7:5452617-5452639 | CCACGCATCAGCCCGGGGAGGCC | No data | ||
Right | 1020112038 | 7:5452639-5452661 | CCCAGGCCTGGTCAGCCTCCAGG | 0: 1 1: 1 2: 5 3: 48 4: 455 |
||||
1020112031_1020112045 | 26 | Left | 1020112031 | 7:5452617-5452639 | CCACGCATCAGCCCGGGGAGGCC | No data | ||
Right | 1020112045 | 7:5452666-5452688 | GCCCGCCAGGCTCAGCTTCCCGG | 0: 1 1: 1 2: 3 3: 26 4: 265 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1020112031 | Original CRISPR | GGCCTCCCCGGGCTGATGCG TGG (reversed) | Intronic | ||