ID: 1020114882

View in Genome Browser
Species Human (GRCh38)
Location 7:5470714-5470736
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020114882_1020114889 7 Left 1020114882 7:5470714-5470736 CCCTTCCCGGGGGGGAGATGTCC 0: 2
1: 0
2: 0
3: 4
4: 79
Right 1020114889 7:5470744-5470766 GAGCTTGGAACACAGCAGAGTGG No data
1020114882_1020114890 14 Left 1020114882 7:5470714-5470736 CCCTTCCCGGGGGGGAGATGTCC 0: 2
1: 0
2: 0
3: 4
4: 79
Right 1020114890 7:5470751-5470773 GAACACAGCAGAGTGGCCCCCGG 0: 1
1: 1
2: 7
3: 52
4: 448
1020114882_1020114891 26 Left 1020114882 7:5470714-5470736 CCCTTCCCGGGGGGGAGATGTCC 0: 2
1: 0
2: 0
3: 4
4: 79
Right 1020114891 7:5470763-5470785 GTGGCCCCCGGCACCTGTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1020114882_1020114892 27 Left 1020114882 7:5470714-5470736 CCCTTCCCGGGGGGGAGATGTCC 0: 2
1: 0
2: 0
3: 4
4: 79
Right 1020114892 7:5470764-5470786 TGGCCCCCGGCACCTGTGAAGGG 0: 1
1: 0
2: 2
3: 13
4: 146
1020114882_1020114886 -8 Left 1020114882 7:5470714-5470736 CCCTTCCCGGGGGGGAGATGTCC 0: 2
1: 0
2: 0
3: 4
4: 79
Right 1020114886 7:5470729-5470751 AGATGTCCACTTCCTGAGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020114882 Original CRISPR GGACATCTCCCCCCCGGGAA GGG (reversed) Intronic
905277744 1:36829876-36829898 GGACATCTTCCTACCAGGAATGG + Intronic
913281382 1:117188318-117188340 GGACATCTGCCCTGCTGGAAGGG - Intronic
915993364 1:160539948-160539970 GGAAAACTTCCCCCCAGGAAGGG + Intergenic
919907082 1:202085560-202085582 GGACAGCCCCACCCCGGGTAGGG + Intergenic
922622942 1:227004910-227004932 GGACATGTCACCCACGGGACAGG + Intronic
922932889 1:229403889-229403911 GCACACCTGCCCCTCGGGAAAGG + Intergenic
923147826 1:231210189-231210211 GGCCATCTCCCCAGCAGGAAGGG + Intronic
923777841 1:236995947-236995969 GGACATCTCCCCTCCCCAAAAGG - Intergenic
924573174 1:245256609-245256631 GGACCTCTCCTCTCCGCGAAGGG + Intronic
1064379078 10:14824313-14824335 GGACATCTCCTGGCCGGGCATGG + Intronic
1071672156 10:87618826-87618848 GGACATCTCCACCCCTGAAAGGG - Intergenic
1078428556 11:11270179-11270201 GGACATCGCCCCGCCAGGGAAGG + Intergenic
1080255117 11:30282003-30282025 GGCCATCTCTCCCACGGGACTGG + Intergenic
1080393161 11:31866504-31866526 GTACATCTCTCCCCCTGGCAGGG + Intronic
1084408428 11:68992163-68992185 GAGCATCTCCCCACCGGGAGGGG - Intergenic
1084679777 11:70660080-70660102 GGCCAACTCTCCCCCAGGAAGGG + Intronic
1085349623 11:75790171-75790193 GGCCATCTGCCCCCCAGGAGTGG + Exonic
1085743555 11:79096405-79096427 GGAAATCTTCCCCCCAGCAAAGG - Intronic
1089214730 11:116828919-116828941 GGACATCTCAGCCCCGAGAAGGG + Intergenic
1090520552 11:127474636-127474658 GGACATATGCCCCCAGGGACTGG + Intergenic
1090846546 11:130534377-130534399 GGACCTCCCCACCCTGGGAAAGG + Intergenic
1091668470 12:2435978-2436000 GGACTTCTCCTCCCCTGGGAGGG - Intronic
1091798284 12:3309537-3309559 GGGCATCTCCCCCTGGGGGAGGG - Intergenic
1106254681 13:28011628-28011650 GGACTCCTCCCACCCGGGGAGGG + Intronic
1112717715 13:102205706-102205728 TGCCATCTCTCCCCCGAGAAAGG + Intronic
1118129121 14:62942415-62942437 TGACTTCTCCCCACCGGAAAAGG - Intronic
1119736523 14:76986150-76986172 GGACTTCTGGCCCCCTGGAAGGG - Intergenic
1125581631 15:40789666-40789688 GGAGTTCTACCCCCTGGGAAAGG - Intronic
1125769064 15:42153176-42153198 GCACATCTCCCCTCCGAGGAGGG + Intronic
1126367544 15:47911399-47911421 GAACATCTCCTCCCTTGGAAAGG + Intergenic
1127050776 15:55081278-55081300 TGACACCTCCCCACCAGGAAGGG - Intergenic
1128527618 15:68423210-68423232 GGACATCTCCCCTACTGAAAAGG - Intronic
1129125052 15:73432373-73432395 GGACATCTCCCCCCAGGCAGAGG - Intergenic
1136045708 16:27613385-27613407 TGACATCTCCCTCCTGGCAAAGG + Intronic
1137767263 16:50987527-50987549 GAACCTCTCCTCCCTGGGAATGG + Intergenic
1141155609 16:81594494-81594516 GAACATATCCCCCATGGGAAAGG - Intronic
1141567943 16:84915893-84915915 GGGGATCTCCCCACAGGGAAAGG + Intronic
1142110895 16:88330679-88330701 AGACTTCTGCCCCCAGGGAAAGG + Intergenic
1143116873 17:4585926-4585948 GGCCATCTCCCACCCTGGATGGG - Intronic
1150654444 17:67030823-67030845 GGACAGCTCCCCCATGGGGATGG - Exonic
1152678376 17:81653229-81653251 GGACCTGTCACCCCCAGGAAAGG - Exonic
1152946039 17:83197749-83197771 GGACATCTCTTCCCAGGGATGGG + Intergenic
1158558976 18:58498157-58498179 GGCCATCTAGCCCCAGGGAAGGG + Intronic
1159057614 18:63481842-63481864 TGACATCACACCCCAGGGAAAGG - Intronic
1160589993 18:79938447-79938469 GGACATCTCCCTCCAGTGAGGGG + Intronic
1161641558 19:5426877-5426899 GTACATCTCCCCCACTGGGAGGG - Intergenic
1165821085 19:38676584-38676606 GGAAACCTCCCACCCGGGCAGGG + Intronic
929008194 2:37415682-37415704 GCACCTCTCCCCTCCAGGAAGGG - Intergenic
935463220 2:103363515-103363537 GGACATCCTGCCACCGGGAAGGG + Intergenic
940253936 2:151709244-151709266 GGACTTCTCCCCCCAGGAAGAGG - Intronic
1169759670 20:9077691-9077713 GGACATGTCCCTGCTGGGAAGGG - Intronic
1174423823 20:50418080-50418102 GGACATCACCCTCCCTAGAACGG - Intergenic
1176229673 20:64025785-64025807 TGTCATCTCCTCCCTGGGAAGGG + Intronic
1179124379 21:38578093-38578115 GGACAACTCCCTCCCGGGCCTGG - Intronic
1179287781 21:39992918-39992940 TGACCTCTCCTCCCCAGGAATGG + Intergenic
1179987385 21:44929247-44929269 GGACAGCTCCCCACCAGGTAGGG - Intronic
1182086571 22:27565176-27565198 GGACATCTCCCACCTGGCATAGG - Intergenic
1183324713 22:37184996-37185018 GCCCATCTCCCCACCGAGAACGG + Intronic
949505210 3:4720860-4720882 GGACATCTCCACCCTGGGTTGGG - Intronic
956066520 3:65402400-65402422 GGAAATCTACCACCAGGGAAGGG + Intronic
960524378 3:118692654-118692676 GGACATTTTCCCCAAGGGAATGG + Intergenic
967888861 3:194351094-194351116 GGACTTCTCCTCCCGGGGCAGGG + Intronic
985954382 5:3252409-3252431 GGACCTCTCCTCCCAGAGAAAGG - Intergenic
987801127 5:22697956-22697978 GGACCTCTCACCCCCAGGACTGG + Intronic
994061241 5:95479761-95479783 GGACATCTCCCCCGCAGATAAGG + Intronic
994630119 5:102274762-102274784 GTACAGCTACCCCCTGGGAAAGG - Intronic
997470125 5:134113090-134113112 GTACCTCTCCCCTCCGGGCAGGG + Intergenic
1006340206 6:33442677-33442699 GGACAGGGCCCCTCCGGGAAGGG - Intronic
1007602664 6:43092565-43092587 GAACATATCCCCCCCAGGATTGG + Intronic
1020114871 7:5470692-5470714 GGACATCTCCCCCCCGGGAAGGG - Intronic
1020114882 7:5470714-5470736 GGACATCTCCCCCCCGGGAAGGG - Intronic
1022140397 7:27488307-27488329 AAACATCTCCTCCCCAGGAATGG + Intergenic
1023894045 7:44417379-44417401 GGACAACTCCCCACTGGAAATGG - Intronic
1023991746 7:45132768-45132790 GGACTTCTCCCCCCAGGTAATGG - Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030966205 7:115995892-115995914 GGACAATTCCCCTCCGGGTAGGG - Intronic
1032648604 7:133853668-133853690 GGACGTCTCCCCACTGGCAATGG - Intronic
1033658317 7:143387827-143387849 GGACATCGCCCCCATGGGACAGG - Intronic
1035163161 7:156966176-156966198 GAACATCTTCCCGCCTGGAAGGG - Intronic
1035368416 7:158363109-158363131 GGCCATCTGGCCCCAGGGAAAGG - Intronic
1039469386 8:37803859-37803881 AGACATCTCCCAGCTGGGAAGGG + Intronic
1044544087 8:93440035-93440057 GGACATTTTCCCTCTGGGAATGG - Intergenic
1049313809 8:141948176-141948198 CCACATATCCCCCCCGGGAGAGG - Intergenic
1061112340 9:128583355-128583377 GGACATATACCCCCCAAGAAAGG + Intronic
1186890544 X:13955383-13955405 GGACATCTCTCCCCCAGAGAAGG - Intergenic