ID: 1020115003

View in Genome Browser
Species Human (GRCh38)
Location 7:5471279-5471301
Sequence GCCCCGGCCCGTGTGTTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020115003_1020115005 -2 Left 1020115003 7:5471279-5471301 CCTCGGAACACACGGGCCGGGGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1020115005 7:5471300-5471322 GCTTTTTCGCTCTGTCGCCCAGG 0: 1
1: 5
2: 57
3: 1623
4: 29036
1020115003_1020115007 12 Left 1020115003 7:5471279-5471301 CCTCGGAACACACGGGCCGGGGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1020115007 7:5471314-5471336 TCGCCCAGGCTGGAGTGCAGTGG 0: 62339
1: 213994
2: 245652
3: 160170
4: 93749
1020115003_1020115006 2 Left 1020115003 7:5471279-5471301 CCTCGGAACACACGGGCCGGGGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1020115006 7:5471304-5471326 TTTCGCTCTGTCGCCCAGGCTGG 0: 859
1: 30259
2: 100424
3: 211056
4: 254407
1020115003_1020115010 23 Left 1020115003 7:5471279-5471301 CCTCGGAACACACGGGCCGGGGC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1020115010 7:5471325-5471347 GGAGTGCAGTGGCGCGATCTCGG 0: 21768
1: 89330
2: 155366
3: 136299
4: 80561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020115003 Original CRISPR GCCCCGGCCCGTGTGTTCCG AGG (reversed) Intronic
900144314 1:1151284-1151306 GGCCCTGCCCGTCTGTTCCGAGG + Intergenic
900305326 1:2003916-2003938 GCCCCGGCCCGCGCGGTCGGTGG - Intergenic
900934170 1:5754939-5754961 GCCCTGGCCAGTGTGTACAGAGG + Intergenic
904190206 1:28737338-28737360 GGCCCGGCCCGTGGGCTCCGAGG - Intronic
904611523 1:31728465-31728487 GCCCAAGCCCGGGGGTTCCGTGG - Intronic
908241849 1:62194971-62194993 GCCCAGGCGCGTGGGGTCCGGGG + Intronic
909169868 1:72282139-72282161 GCCCCGGCCCGTTTATGCTGGGG - Intronic
1064423935 10:15213664-15213686 GCCCCAGCCCCTGTCTTCCCAGG - Exonic
1068828835 10:61469693-61469715 GCCCCTGACCGTGGATTCCGGGG - Intergenic
1069818390 10:71212846-71212868 GCGCCAGCCCGTGCCTTCCGTGG - Exonic
1073240646 10:102055820-102055842 GACCGGGACCGTGTGGTCCGAGG + Intronic
1076802354 10:132836439-132836461 GCCACGGCCAGTGAGTTCTGTGG + Intronic
1081861036 11:46333395-46333417 GCCCTGGCCCGAGGGTTCCCGGG + Intronic
1083922010 11:65786391-65786413 GCCCCGGCCGGTGTGTGGGGAGG - Intergenic
1104315156 12:127691806-127691828 GCCCCTCCCCGTGTGTTCAGAGG + Intergenic
1104596419 12:130123169-130123191 GCCCGGGGACGTGTGTTCCACGG + Intergenic
1104761320 12:131299002-131299024 GCCCCGGCGCGGGTCTTCTGCGG - Intergenic
1104818455 12:131661790-131661812 GCCCCGGCGCGGGTCTTCTGCGG + Intergenic
1104837564 12:131801435-131801457 GCCGTGGCCCGTGTTTGCCGTGG + Intergenic
1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG + Intergenic
1104837587 12:131801585-131801607 GCCGTGGCCCGTGTTTGCCGTGG + Intergenic
1104837600 12:131801684-131801706 GCCGTGGCCCGTGTTTGCCGTGG + Intergenic
1105804548 13:23945679-23945701 GCCCCGTCCCATGGGTTGCGGGG + Intergenic
1106518206 13:30473190-30473212 GCCTCAGCCCGAGTTTTCCGGGG + Intronic
1114522401 14:23347609-23347631 GCCCTGGCCTGTGTCTTCCTGGG - Exonic
1118220934 14:63853676-63853698 GCCCCGACCCGCGGGTTCCCGGG - Intronic
1120789239 14:88563531-88563553 GCCCCCGCCCGGGGGATCCGAGG + Intronic
1122264349 14:100539704-100539726 TCCCAGGCCCGTGGGTTCTGTGG + Intronic
1122817191 14:104319589-104319611 GCCCCGTTCTGTGTGTTCTGTGG + Intergenic
1122947689 14:105020759-105020781 GCCCGGGCCCCTCTGTTCCCCGG + Intronic
1125674549 15:41495147-41495169 GCCCAGGGCTGTGTTTTCCGAGG - Intronic
1132178459 15:99733539-99733561 GCCCCGGGCCCTGTGGTCCCGGG - Intronic
1136277091 16:29185225-29185247 GCCCACGCCCGTGTGATCTGGGG - Intergenic
1136909672 16:34135352-34135374 GCCCGGGCCTGTGTTTCCCGGGG + Intergenic
1137403355 16:48171187-48171209 CCCCCAGCCCATGTGTTCCAGGG + Intronic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138104868 16:54282554-54282576 GCCCCGGCGCGGGGGTTGCGGGG - Intergenic
1142081467 16:88151270-88151292 GCCCGCGCCCGTGTGATCTGGGG - Intergenic
1142600669 17:1052173-1052195 GCCCCGTTCTGTGTGTTCTGAGG - Intronic
1143608408 17:8003652-8003674 GCCCCGGGCCCTGAGTGCCGTGG - Exonic
1145888448 17:28398400-28398422 GCCAAGGCCAGTGTGTTCAGAGG + Exonic
1147979845 17:44267799-44267821 GCTCCGGTGCGTGTGTTGCGGGG - Intronic
1151961561 17:77408495-77408517 GCACCGGGCCGTGTGTTCCAGGG + Intronic
1160845447 19:1164154-1164176 GCCCCTGCCCATGGCTTCCGGGG + Intronic
1161594046 19:5142246-5142268 GCCCAGGCCAGTGTGTGCCGGGG - Intronic
1165136486 19:33673100-33673122 GCCCAGGGCTGTGTGGTCCGTGG + Intronic
1167043612 19:47037508-47037530 GCCCAGGTCTGTCTGTTCCGGGG + Intronic
928197215 2:29224584-29224606 GCCCTGGCCCATGTGTTGGGGGG - Intronic
948140705 2:235670267-235670289 GCCCCGGCCCGCGCGCTCCCCGG + Intronic
1168771879 20:420851-420873 GCCCCGCCCCGTGTGCCCAGCGG + Exonic
1171905151 20:30894074-30894096 GCCCGGGCCGGTGTTTCCCGGGG + Intergenic
1172744320 20:37194802-37194824 GCCCCAGCCAGTGTGTGCCTGGG + Intronic
1173913581 20:46689266-46689288 GCCGAGGCGCGCGTGTTCCGTGG - Exonic
1175394724 20:58650482-58650504 GCCCCGGGCCGGGTTTTCCACGG - Intergenic
1180157929 21:45986966-45986988 GCGCCGGTACGTGTGGTCCGTGG - Exonic
1180338577 22:11600254-11600276 GCCCGGGCCAGTGTTTCCCGGGG + Intergenic
1180871513 22:19149618-19149640 GCCGCGGCCCGCGCGCTCCGGGG + Intronic
1181486600 22:23235521-23235543 GTCCAGGCCCATGTGTTCCACGG + Intronic
1183761038 22:39818291-39818313 GCCCCAGCCTTTGTGTTCCCTGG + Intronic
1184265026 22:43342275-43342297 GCCCAGGCCCGTGGGTTTCACGG - Intronic
1185182628 22:49372083-49372105 TCCCCGGGCCGTGTCTTCTGTGG - Intergenic
950112481 3:10428425-10428447 TCCCCGTCCTGTGAGTTCCGGGG + Intronic
968549513 4:1214864-1214886 GCCCAGGGCCGTCTGTTCTGAGG + Intronic
968583925 4:1407197-1407219 GCCCCCTCCCGCGCGTTCCGTGG + Intergenic
969621175 4:8279695-8279717 GCCCAGGTCCCTGTGTGCCGTGG + Intronic
1000025841 5:157358510-157358532 TCCCAGGCCTGTGTGTTCCCAGG + Intronic
1001652106 5:173323430-173323452 TCCCCGGCCTGTGTGTTCTCAGG - Exonic
1002169538 5:177367380-177367402 GCCCCGGCTCACCTGTTCCGGGG + Intronic
1002184256 5:177446951-177446973 GCCTGGGCCCGTGAGTACCGCGG + Exonic
1019219080 6:170460797-170460819 CCCCCGGCCCCTGTGTTTTGTGG - Intergenic
1019773325 7:2897219-2897241 GCCCAGGCCTGTGCGTTCAGCGG - Intergenic
1020115003 7:5471279-5471301 GCCCCGGCCCGTGTGTTCCGAGG - Intronic
1020138392 7:5599072-5599094 GCCCCAGCCCTCGTGTTCCCTGG + Intronic
1021934363 7:25615272-25615294 GCCCTGGCCCTGGTGTCCCGTGG - Intergenic
1024636893 7:51298490-51298512 GCCCCAGCCCATGTGTTAGGAGG - Intronic
1035727737 8:1835063-1835085 CCCCCGGCCCGTGTCTGCCAAGG + Intronic
1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG + Intergenic
1049520194 8:143083985-143084007 GCTCCGGCAATTGTGTTCCGTGG - Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1185471447 X:386451-386473 GGCCCGGCCCGGGGGTTCCCGGG + Exonic
1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG + Intergenic
1194885533 X:99311527-99311549 GCCCCATTCCGTGTGTTCTGAGG + Intergenic
1195315801 X:103676714-103676736 GCCCGGGCCCTTTTCTTCCGAGG + Exonic
1195320644 X:103719118-103719140 GCCCCTGCCCGTGTGGGCCTGGG - Exonic