ID: 1020116381

View in Genome Browser
Species Human (GRCh38)
Location 7:5478635-5478657
Sequence CTGTGGGGTTGGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2227
Summary {0: 1, 1: 1, 2: 45, 3: 370, 4: 1810}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020116381_1020116390 1 Left 1020116381 7:5478635-5478657 CCTCCCTCCCTCCAACCCCACAG 0: 1
1: 1
2: 45
3: 370
4: 1810
Right 1020116390 7:5478659-5478681 CTCTCCCTCACATACACACACGG 0: 1
1: 0
2: 9
3: 44
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020116381 Original CRISPR CTGTGGGGTTGGAGGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr