ID: 1020116982

View in Genome Browser
Species Human (GRCh38)
Location 7:5481545-5481567
Sequence GGTGACATGAGGGGGCTCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020116982 Original CRISPR GGTGACATGAGGGGGCTCGG GGG (reversed) Exonic