ID: 1020117490

View in Genome Browser
Species Human (GRCh38)
Location 7:5484059-5484081
Sequence CACATGACCCGTGGTGTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020117490_1020117493 -8 Left 1020117490 7:5484059-5484081 CCGTGAACACCACGGGTCATGTG 0: 1
1: 0
2: 1
3: 14
4: 276
Right 1020117493 7:5484074-5484096 GTCATGTGGCAGACGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020117490 Original CRISPR CACATGACCCGTGGTGTTCA CGG (reversed) Intronic
900665041 1:3809465-3809487 CACATGAGCCCTGGAGGTCAAGG - Intergenic
903018661 1:20378350-20378372 CACTTGAGCCTGGGTGTTCAAGG + Intergenic
903048864 1:20586298-20586320 CACCTGAGCCTAGGTGTTCAAGG - Intergenic
903293073 1:22326813-22326835 CACATGCATCCTGGTGTTCAAGG + Intergenic
903909882 1:26715787-26715809 CACATGAGCCCTGGAGTTCCAGG + Intronic
905081714 1:35328363-35328385 CACTTGACCCCAGGAGTTCAAGG - Intronic
905426915 1:37893163-37893185 CACATGAGCCCTGGAGGTCAAGG - Intronic
905808239 1:40892558-40892580 CACATGAGCCCAGGAGTTCAAGG - Intergenic
906175529 1:43768355-43768377 CACTTGAGCCCAGGTGTTCAAGG + Intronic
906187896 1:43875506-43875528 CCCATGACACGTGGGGTTTATGG - Intronic
906667628 1:47632647-47632669 CACATGCCCTATGGGGTTCATGG - Intergenic
907363458 1:53940791-53940813 CACTTGAGCCCTGGAGTTCAGGG - Intronic
908113382 1:60918542-60918564 CAGAAGACCTGTGATGTTCACGG - Intronic
910308696 1:85798111-85798133 CACTTGAGCCTAGGTGTTCAAGG + Intronic
913371130 1:118101194-118101216 CACTTGAGCCCAGGTGTTCAAGG + Intronic
914756754 1:150566778-150566800 CACTTGAGCCCTGGAGTTCAGGG - Intergenic
915396021 1:155584822-155584844 CACTTGAGCCCAGGTGTTCAAGG - Intergenic
915414420 1:155729698-155729720 CACTTGAGCCCTGGAGTTCAAGG + Intronic
917315455 1:173720036-173720058 CACTTGAGCCTAGGTGTTCAAGG + Intronic
917442520 1:175079926-175079948 CACAAGACCAGTGGTCCTCAAGG - Intronic
917653818 1:177105910-177105932 CACTTGAGCCCTGGAGTTCAAGG + Intronic
918580305 1:186119277-186119299 CACGTGACCCTTCATGTTCATGG + Exonic
918603174 1:186388261-186388283 CACTTGAGCCCAGGTGTTCAAGG + Intronic
919388487 1:196952190-196952212 CACTTGAGCCCAGGTGTTCAAGG + Intronic
919890161 1:201966433-201966455 CACTTGACCCCAGGAGTTCAAGG + Intronic
921900604 1:220446349-220446371 CACATGAGCCCAGGAGTTCAAGG + Intergenic
1063462161 10:6221783-6221805 CACATGACCACTGCTGTGCAGGG + Intronic
1063850966 10:10189907-10189929 CACATGAGCCCAGGAGTTCAAGG - Intergenic
1063991330 10:11567028-11567050 CACTTGAGCCGAGGAGTTCAAGG + Intronic
1064460363 10:15529166-15529188 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1065587681 10:27235892-27235914 CACCTGACCCCAGGAGTTCAAGG + Intronic
1065700447 10:28420272-28420294 CACTTGACCCTGGGAGTTCAAGG - Intergenic
1065777547 10:29134934-29134956 CACTTGAGCCTAGGTGTTCAAGG + Intergenic
1065922247 10:30403034-30403056 CACTTGAGCCGAGGAGTTCAAGG - Intergenic
1066481948 10:35805031-35805053 CACTTGAGCCCTGGGGTTCAAGG - Intergenic
1068843751 10:61647199-61647221 CACTTGAGCCCAGGTGTTCAAGG + Intergenic
1069974319 10:72199949-72199971 CACTTGAGCCCAGGTGTTCAAGG - Intronic
1070438417 10:76416239-76416261 CACATGACCCTTGCTGTGGAGGG + Intronic
1070588132 10:77781490-77781512 CACATCACCCACGGTGTGCAAGG + Intergenic
1072387064 10:94941666-94941688 CAGATGGCCTGTGATGTTCAAGG - Intronic
1073442497 10:103560658-103560680 CACAGGGGCTGTGGTGTTCATGG + Intronic
1074141698 10:110679305-110679327 CACTTGAGCCGAGGCGTTCAAGG - Intronic
1079052735 11:17176700-17176722 CACTTGAGCCCAGGTGTTCAAGG + Intronic
1080322987 11:31036616-31036638 CACTTGTCCCTTGGTATTCATGG + Intronic
1080791646 11:35526805-35526827 CCCATGACACGTGGGGTTTATGG - Intronic
1084194270 11:67515312-67515334 CACTTGTCCCTGGGTGTTCAAGG - Intergenic
1085146137 11:74199556-74199578 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1085450812 11:76631136-76631158 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
1086929279 11:92674604-92674626 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1088861650 11:113806010-113806032 CACTTGAGCCCAGGTGTTCAAGG - Intronic
1089507751 11:118975529-118975551 CACTTGAGCCGAGGAGTTCAAGG - Intronic
1091146996 11:133288699-133288721 AACAAAACCAGTGGTGTTCAGGG - Intronic
1094695446 12:32813696-32813718 CACTTGAACCCTGGTGGTCAAGG + Intronic
1096329990 12:50702636-50702658 CACATGGGCCGAGGAGTTCAAGG + Intronic
1096689562 12:53311518-53311540 CACTTGAGCCCAGGTGTTCAAGG + Intronic
1097283571 12:57860864-57860886 CACTTGAACCCTGGAGTTCAAGG - Intergenic
1100480738 12:94975958-94975980 CACATGAGCCCAGGAGTTCAAGG + Intronic
1100499724 12:95162181-95162203 CACATGAGCCCAGGAGTTCAAGG + Intronic
1101641783 12:106590861-106590883 CACTTGAGCCCAGGTGTTCAAGG + Intronic
1101958422 12:109230504-109230526 CACATGAGCCCAGGAGTTCAAGG - Intronic
1102974064 12:117193467-117193489 CACTTGAGCCTAGGTGTTCAAGG + Intergenic
1103427710 12:120851685-120851707 CACCTGACCCGGGGAGGTCAAGG - Intronic
1103580022 12:121907951-121907973 CACTTGACCCTAGGAGTTCAAGG + Intronic
1103592671 12:122003487-122003509 CACTTGACCCCAGGAGTTCAAGG + Intronic
1103906267 12:124328657-124328679 CACTTGCCCCGTGGTGGGCACGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104458853 12:128937657-128937679 CCCATGACACGTGGAGATCACGG - Intronic
1105030876 12:132882787-132882809 CACATGAGCCTGGGAGTTCAAGG - Intronic
1105386338 13:19933030-19933052 CACTTGAGCCCAGGTGTTCAAGG - Intergenic
1105519668 13:21120884-21120906 CACTTGACCCCAGGAGTTCAAGG - Intergenic
1107386083 13:39911104-39911126 CACTTGGCCTGTGGTGTTGAAGG + Intergenic
1107829038 13:44358034-44358056 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
1110579381 13:77101506-77101528 CATATGACAAGTGGTGTTCCTGG - Intronic
1112348772 13:98615318-98615340 CACATGAGCCTAGGAGTTCAAGG - Intergenic
1112440416 13:99420947-99420969 CACGTGACTTGTGTTGTTCAAGG - Intergenic
1113080193 13:106511395-106511417 CACTTGAGCCCTGGAGTTCAAGG + Intronic
1114864700 14:26574738-26574760 CACATGAGCCCAGGTGTTAAGGG - Intronic
1116228645 14:42186217-42186239 CACAGGACCCTGGGTGATCAAGG - Intergenic
1117047994 14:51832194-51832216 CACTTGACCCCAGGAGTTCAAGG + Intronic
1117121798 14:52575957-52575979 CACATGAGCTGTGTTGTTCGGGG + Intronic
1117889351 14:60401374-60401396 CACTTGACCCCAGGAGTTCAAGG + Intronic
1118229311 14:63932618-63932640 CACTTGAGCCGTGGAGTTCCAGG + Intronic
1120882726 14:89426893-89426915 GACAGGACCCGTGGGGTACAAGG + Intronic
1121296146 14:92826069-92826091 CACATGAGCCTAGGAGTTCAAGG + Intronic
1122103862 14:99436170-99436192 CCCTTGACACGTGGTGATCACGG + Intronic
1122163653 14:99804859-99804881 CCCATGACTCTTGGGGTTCAGGG + Intronic
1124467891 15:29955665-29955687 CACATGAGCCCAGGTGTTCAAGG + Intronic
1125594354 15:40874735-40874757 CACTTGACCCCAGGAGTTCAAGG + Intergenic
1125621239 15:41064461-41064483 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1128207348 15:65865134-65865156 CACTTGAGCCGAGGAGTTCAAGG - Intronic
1128788651 15:70416556-70416578 GACATGACCTGTGATGTTGAAGG + Intergenic
1128870029 15:71147743-71147765 CACTTGAGCCGAGGAGTTCAAGG + Intronic
1129066231 15:72906637-72906659 CACATGAGCCCAGGAGTTCAAGG + Intergenic
1130642198 15:85687954-85687976 CACTTGAGCCGAGGAGTTCAAGG + Intronic
1130982443 15:88822060-88822082 CACCTGAGCCTTGGTATTCAGGG + Intronic
1132002576 15:98194773-98194795 CACATGCCACGTGGTGCACACGG - Intergenic
1132469719 16:95651-95673 CACTTGAGCCCTGGTGTTCGAGG - Intronic
1135385641 16:22037184-22037206 CACTTGAACCCAGGTGTTCAAGG + Intronic
1135663004 16:24312732-24312754 CACTTGAGCCCTGGAGTTCAAGG + Intronic
1136011924 16:27369067-27369089 CACATGAGCCCAGGTGTTCAAGG - Intergenic
1136249015 16:28991512-28991534 CACTTGACCCCAGGAGTTCAAGG - Intergenic
1136347856 16:29687896-29687918 CACATGAGCCCGGGAGTTCAAGG + Intronic
1138474296 16:57261635-57261657 CACATGAGCCCAGGGGTTCAAGG + Intronic
1138668187 16:58590679-58590701 CACATGAGCCCAGGAGTTCAAGG + Intronic
1140446498 16:75032927-75032949 CACTTGAGCCAAGGTGTTCAAGG + Intronic
1141187080 16:81795781-81795803 CACTTGATCCGAGGAGTTCAAGG - Intronic
1141706995 16:85671528-85671550 CACATGAGCCCAGGAGTTCAAGG + Intronic
1144947522 17:18977549-18977571 CTCGTGACCCCTGGTGTGCAGGG + Intronic
1146199946 17:30848327-30848349 CACCTGACCCTTGGAGGTCACGG - Intronic
1147676381 17:42209116-42209138 CACTTGACCCTGGGAGTTCAAGG - Intronic
1148829471 17:50421415-50421437 CACTTGACCCCAGGAGTTCAAGG + Intergenic
1149069805 17:52526490-52526512 CCCATGACACGTGGGGATCATGG - Intergenic
1149565620 17:57638816-57638838 CACTTGACCCGAGAAGTTCAGGG + Intronic
1149704358 17:58682043-58682065 CACTTGACCCCTGGGGGTCAAGG - Intronic
1150131390 17:62671153-62671175 CACTTGACCCGGGGAGGTCAAGG - Intronic
1152050463 17:77970923-77970945 CACTTGAGCTGTGGAGTTCAAGG + Intergenic
1154982967 18:21519377-21519399 CACGTGACCCCAGGAGTTCAAGG + Intronic
1155141634 18:23049596-23049618 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
1155504880 18:26523565-26523587 CACTTGAGCCCAGGTGTTCAAGG + Intronic
1156215061 18:34989625-34989647 CACTTGAACCTGGGTGTTCAAGG + Intronic
1158166396 18:54546219-54546241 CCCATGACATGTGGGGTTCATGG - Intergenic
1158641848 18:59210496-59210518 CACATGGCCCCTGCTGTTCAGGG + Intergenic
1159857586 18:73607609-73607631 CACTTGACCCTGGGAGTTCAAGG - Intergenic
1162115252 19:8425462-8425484 CACTTGAGCCGAGGAGTTCAAGG - Intronic
1162251088 19:9444252-9444274 CACTTGAGCCCTGGAGTTCAAGG - Intergenic
1162849883 19:13422763-13422785 CACCTGAGCCTTGGTGTCCAGGG - Intronic
1162872168 19:13594764-13594786 CACATGAGCCCAGGGGTTCAAGG + Intronic
1165039006 19:33055546-33055568 CACATGACCCACGCTGTTCCTGG + Intronic
1165912656 19:39238500-39238522 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
1166034506 19:40157838-40157860 CACTTGAGCCCTGGAGTTCAAGG - Intergenic
1166286484 19:41833091-41833113 CACATGAGCCTAGGAGTTCAAGG - Intergenic
1167341151 19:48917137-48917159 CACTTGAGCCGAGGAGTTCAAGG + Intronic
926037632 2:9647611-9647633 CAGATGACATGTGGTGTCCAAGG - Intergenic
929809985 2:45181670-45181692 CACTTGAGCCAAGGTGTTCAAGG - Intergenic
930087095 2:47505249-47505271 CACTTGAGCCTTGATGTTCAGGG - Intronic
933370395 2:81407891-81407913 CACTTGACCCCAGGAGTTCAAGG + Intergenic
934071950 2:88392509-88392531 CACTTGAGCCCTGGAGTTCAAGG - Intergenic
935306916 2:101746072-101746094 CACTTGAGCCCTGGAGTTCAAGG - Intronic
935657781 2:105439571-105439593 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
936047149 2:109196738-109196760 CACATGCCCCGTGGCCTTCTGGG + Intronic
938415374 2:131099695-131099717 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
939418633 2:141935867-141935889 CACTTGAGCCCAGGTGTTCAAGG + Intronic
939524489 2:143275811-143275833 CAAATGAACAGTGGTGTTAAAGG - Intronic
940325155 2:152417551-152417573 CACATCACCCAAGGTGATCAGGG + Intronic
940879522 2:158932797-158932819 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
942773683 2:179554236-179554258 CACATGACCCCTGCCGTTTATGG - Intronic
943185937 2:184607597-184607619 CCCATGACACGTGGTGATTATGG + Intronic
944177962 2:196854859-196854881 CACTTGAGCCCAGGTGTTCAAGG - Intronic
945591381 2:211736077-211736099 CACTTGAGCCCTGGAGTTCAAGG + Intronic
945696457 2:213112543-213112565 CACTTGAGCCCTGGAGTTCATGG - Intronic
948253295 2:236548246-236548268 CTCATGATCAGTGGTATTCAGGG + Intergenic
948966562 2:241386174-241386196 CACTTGAGCCTTGGAGTTCAAGG - Intronic
1168807993 20:684100-684122 CACTTGACCCCAGGAGTTCAAGG - Intergenic
1171171430 20:23019065-23019087 CACAAGGCCAATGGTGTTCAAGG - Intergenic
1171445606 20:25201797-25201819 CACTTGAGCCTTGGAGTTCAAGG - Intronic
1172228128 20:33318870-33318892 CACCTGAGCCCTGGAGTTCAAGG + Intergenic
1172477022 20:35246747-35246769 CAAATGATCCCTCGTGTTCAAGG + Intronic
1173984099 20:47247743-47247765 CCCATGCCCCGGGCTGTTCATGG - Intronic
1175842922 20:62041848-62041870 CACATGAGCCCAGGAGTTCAAGG + Intronic
1176370176 21:6057663-6057685 CACTTGAACCCTGGAGTTCAAGG - Intergenic
1176725848 21:10431904-10431926 CACTTGACCCCAGGAGTTCAAGG - Intergenic
1177376768 21:20280372-20280394 CACATGACACGTGGAGATTATGG - Intergenic
1178180628 21:30157076-30157098 CTCATGACACGTGGAGGTCACGG + Intergenic
1179753343 21:43480878-43480900 CACTTGAACCCTGGAGTTCAAGG + Intergenic
1179809827 21:43864026-43864048 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
1181976045 22:26730699-26730721 CACCTGAGCCTTGGTGTTCAGGG + Intergenic
1182393000 22:30015128-30015150 CACTTGACCCTGGGAGTTCAAGG - Intronic
1183460908 22:37949919-37949941 CACATGAGCCCAGGAGTTCAAGG - Intronic
953291261 3:41666124-41666146 CACCTGAGCCTTGGTGTCCAGGG + Intronic
954496644 3:50970808-50970830 CACTTGACCCCAGGAGTTCATGG - Intronic
955951738 3:64249645-64249667 CAGATGACCAGTAGGGTTCAAGG - Intronic
956485665 3:69719646-69719668 CACACAACCCGTGGTGGTGATGG + Intergenic
956822836 3:72969307-72969329 CACTTGACCCCAGGAGTTCAAGG + Intronic
957680200 3:83424116-83424138 AAAATGACCAGTGTTGTTCATGG + Intergenic
958431827 3:94048673-94048695 CACTTGAGCCCTGGAGTTCAAGG - Intronic
959039163 3:101401012-101401034 CACTTGACCCCAGGAGTTCAAGG + Intronic
959279301 3:104317281-104317303 CACAAGGCCTGTGGTGGTCATGG + Intergenic
959682937 3:109116694-109116716 CACTTGAGCCCTGGAGTTCAAGG + Intronic
960206610 3:114908527-114908549 CACATGACCTGAGTTGTTGAAGG - Intronic
962430705 3:135316779-135316801 CACATGTCACCTGGAGTTCATGG + Intergenic
963850343 3:150204645-150204667 CACATGACCAGTGGTATGCCAGG + Intergenic
963948703 3:151174799-151174821 CACATGAGCCCAGGAGTTCAAGG - Intronic
964171462 3:153775325-153775347 CACTTGAGCCGAGGAGTTCAAGG - Intergenic
964898588 3:161628874-161628896 CACTTGAGCCTTGGTGTCCAGGG - Intergenic
966148757 3:176842704-176842726 CACTGGAGCCTTGGTGTTCAGGG - Intergenic
966320527 3:178696254-178696276 CCCATGACCTGTGGGGATCATGG + Intronic
969062086 4:4444453-4444475 CACCTGAGCCTTGGTGTTCAGGG - Intronic
972111735 4:35570187-35570209 CACATGTCCTGTGGTGAGCATGG - Intergenic
972506000 4:39720825-39720847 CACTTGAGCCCTGGAGTTCAGGG - Intronic
975163593 4:71151698-71151720 CACTTGACCCCGGGAGTTCAAGG + Intergenic
976319739 4:83700079-83700101 CACTTGACCCCAGGAGTTCAAGG + Intergenic
976910606 4:90300907-90300929 CACATGAGCCTTGGAGGTCAAGG - Intronic
978767872 4:112422961-112422983 CACAGGGCCAGTTGTGTTCAAGG + Intronic
979443416 4:120780358-120780380 CACTTGAGCCCAGGTGTTCAAGG + Intronic
979630714 4:122899736-122899758 CACTTGAGCCTTGGAGTTCAAGG + Intronic
979886967 4:126040378-126040400 CACTTGAACCTTGGTGTCCAGGG + Intergenic
980422921 4:132586641-132586663 CACATGAGCCTTGGTGTCCAGGG - Intergenic
981030600 4:140121840-140121862 CCCATGACACGTGGGGATCATGG - Intronic
982710418 4:158752886-158752908 CACATGAACCCAGGAGTTCAAGG + Intergenic
985052640 4:186008251-186008273 CACATGACCCAAGGTGTTCAGGG + Intergenic
985105661 4:186497332-186497354 CCCATGACACGTGGTGATTATGG + Intronic
987058060 5:14214249-14214271 TCCATAAGCCGTGGTGTTCATGG + Intronic
988470676 5:31534018-31534040 CACATGACCTGTTGAGTTCAAGG + Intronic
989948221 5:50265252-50265274 CTCATGACTCATGTTGTTCAAGG - Intergenic
991130889 5:63121285-63121307 CTCATGACCCCTGGAGTGCAGGG + Intergenic
991608262 5:68424792-68424814 CACATGAGCCTGGGTGTTCAAGG - Intergenic
992473630 5:77081566-77081588 CACTTGAGCCCAGGTGTTCAAGG - Intronic
994741720 5:103626981-103627003 CACATGAGCCCTGGAATTCAAGG + Intergenic
995109170 5:108409173-108409195 CACTTGAGCCCTGGAGTTCAAGG + Intergenic
995519176 5:112984786-112984808 CACTTGAGCCGAGGTGTTCAAGG - Intronic
995562968 5:113402876-113402898 CACTTGAACCCTGGAGTTCAAGG - Intronic
995579313 5:113578277-113578299 CACTTGAGCCTTGGAGTTCAGGG - Intronic
996050412 5:118926012-118926034 CACTTGAGCCCTGGAGTTCAAGG + Intronic
996085955 5:119305509-119305531 CACATGAGCCCAGGAGTTCAAGG + Intronic
996250913 5:121330989-121331011 CTCATGACACGTGGTGATTATGG - Intergenic
997535694 5:134619441-134619463 CACTTGACCCTAGGTGTTCAAGG - Intronic
998344896 5:141453350-141453372 CACTTGACCCCAGGAGTTCAGGG - Intronic
999190255 5:149741948-149741970 AACATGAACCCTGGTGTTAAAGG + Intronic
999337183 5:150731820-150731842 CAGATGACCACTGGTGTTCCAGG - Intronic
1001720434 5:173852588-173852610 CACATGAGCCCAGGAGTTCAAGG + Intergenic
1003116768 6:3288565-3288587 CAGATGACCTGTTGTGGTCAGGG - Intronic
1003759565 6:9161498-9161520 CACTTGAACCCTGGAGTTCAAGG + Intergenic
1004718592 6:18243881-18243903 CACTTGAACCCTGGAGTTCAAGG + Intronic
1007329506 6:41093934-41093956 CACATGAGCCGAGGAATTCAAGG + Intronic
1008449557 6:51635008-51635030 CATATGAGCCCTGGTGTTCAGGG - Intronic
1009956663 6:70463331-70463353 CACTTGAGCCCAGGTGTTCAAGG - Intronic
1011536196 6:88378948-88378970 CACAAGACAAGTGATGTTCAAGG + Intergenic
1012707860 6:102556752-102556774 CACTTGAGCCCAGGTGTTCAAGG - Intergenic
1014430713 6:121367024-121367046 CACTTGACCCCAGGTGGTCAAGG + Intergenic
1015016870 6:128424147-128424169 CACTTGAGCCCTGGAGTTCAAGG + Intronic
1015520468 6:134125565-134125587 CACTTGAGCCTTGGAGTTCAAGG - Intergenic
1020117490 7:5484059-5484081 CACATGACCCGTGGTGTTCACGG - Intronic
1021092205 7:16496829-16496851 CCCATGACCTGTGGGGCTCATGG + Intronic
1021742281 7:23699199-23699221 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1021989347 7:26127105-26127127 CACATTACTCATGGTGTCCAAGG - Intergenic
1022538367 7:31112576-31112598 CAGATGCCCCCAGGTGTTCAGGG + Intergenic
1022751477 7:33231220-33231242 CACATGACCTCAGGAGTTCATGG - Intronic
1024794690 7:53007418-53007440 AACATGTGCCGTGGTGGTCATGG + Intergenic
1027550966 7:79594716-79594738 CCCATGACACGTGGGGTTTATGG - Intergenic
1028206376 7:88021954-88021976 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1028949473 7:96618865-96618887 CACTTGAGCCCAGGTGTTCAAGG + Intronic
1029103770 7:98157166-98157188 CACTTGAGCCCAGGTGTTCAAGG + Intronic
1029419009 7:100462598-100462620 CACATGAGCCCAGGAGTTCAAGG - Intronic
1030290802 7:107870881-107870903 CACATGAGCCTAGGAGTTCAAGG + Intergenic
1031163575 7:118198963-118198985 CTCTTGAGCCTTGGTGTTCAGGG - Intergenic
1032104052 7:129010248-129010270 CACTTGACCCCAGGAGTTCAAGG - Intronic
1032450010 7:132022532-132022554 CACTTGACCCCAGGAGTTCAAGG - Intergenic
1033429566 7:141276636-141276658 CCCATGACACGTGGGGATCATGG + Intronic
1034195915 7:149247190-149247212 CACTTGAGCCCTGGAGTTCAAGG - Intronic
1034442955 7:151096367-151096389 AAGATGACCCTGGGTGTTCACGG - Intronic
1034612018 7:152379646-152379668 CACTTGACCCCAGGAGTTCAAGG + Intronic
1034658351 7:152747492-152747514 CACATGAGCCCAGGAGTTCAAGG - Intergenic
1037085484 8:14844075-14844097 CAGTTGACCCTTGGTATTCATGG + Intronic
1037108518 8:15138490-15138512 CCCATGACCCGTGGGGATTATGG - Intronic
1037142819 8:15539218-15539240 CACATTACCAAAGGTGTTCATGG + Intronic
1038321256 8:26529411-26529433 CACATGAGCCCAGGAGTTCAAGG - Intronic
1039215305 8:35263476-35263498 CACATGAACCCAGGAGTTCAAGG - Intronic
1039533900 8:38290130-38290152 CACTTGAGCCCTGGAGTTCAAGG + Intronic
1040018893 8:42722643-42722665 CACTTGAGCCTGGGTGTTCAAGG - Intronic
1040033470 8:42846338-42846360 CACATGAGCCCAGGTGTTCAAGG + Intergenic
1040071854 8:43195166-43195188 CCCATGCCCCGAGGTGTTCCAGG - Intronic
1040485193 8:47864454-47864476 CACATGGCCTCTGCTGTTCAAGG - Intronic
1040543807 8:48381550-48381572 CACTTGACCCTGGGAGTTCAAGG - Intergenic
1041249061 8:55917267-55917289 CACATGAGCCTAGGAGTTCAAGG - Intronic
1041457439 8:58076039-58076061 CACTTGACCCCAGGAGTTCAAGG - Intronic
1047018252 8:120746481-120746503 CCCAAGCCCCGTGTTGTTCAAGG + Intronic
1048115605 8:131518528-131518550 CACTTGACCCCAGGAGTTCAAGG - Intergenic
1051267813 9:15325430-15325452 CACATGAGCCCAGGAGTTCAAGG + Intergenic
1051836929 9:21349470-21349492 CACATGACCACTGCTGTTCCTGG + Intergenic
1053290752 9:36878377-36878399 CACATGACCCAACGTGTTCAAGG - Intronic
1053917976 9:42958202-42958224 CACATGAGCCCAGGAGTTCAAGG + Intergenic
1054379318 9:64471963-64471985 CACATGAGCCCAGGAGTTCAAGG + Intergenic
1055109856 9:72549313-72549335 CACTTGAACCCTGGAGTTCAAGG - Intronic
1055538799 9:77279016-77279038 CACATGCCCCTTGGGCTTCAGGG - Intronic
1056430891 9:86526791-86526813 CACATGCCCAGTGTTCTTCAAGG - Intergenic
1056743132 9:89277219-89277241 CAAGTGGCCTGTGGTGTTCAAGG + Intergenic
1060930007 9:127483361-127483383 CACATGAGCCCAGGAGTTCAAGG + Intronic
1061038384 9:128125988-128126010 CACATGAACCCCGGAGTTCAAGG - Intronic
1061239835 9:129363390-129363412 CACTTGACCCCAGGAGTTCAAGG + Intergenic
1061310735 9:129760566-129760588 CACTTGACCCCAGGTGTTCAAGG + Intergenic
1188342312 X:29019180-29019202 CCCATGACCCGTGGGGATTATGG + Intronic
1190370966 X:49740301-49740323 CACTTGAGCCTTGGTGTCCAAGG + Intergenic
1190441569 X:50480129-50480151 CACCTGAGCCTTGGTGTCCAGGG + Intergenic
1193291060 X:79773093-79773115 CACATGACACGTGGGGATTATGG + Intergenic
1193525360 X:82581600-82581622 CACATCACCCGGGAAGTTCAAGG - Intergenic
1193682047 X:84533603-84533625 CACTTGAGCCCAGGTGTTCAAGG + Intergenic
1195015411 X:100774798-100774820 CACTTGACCCCAGGAGTTCAAGG + Intergenic
1196941110 X:120776802-120776824 CCCATGACACGTGGGGTTTATGG + Intergenic
1198679496 X:139166173-139166195 CACATGACACGTGGGGATTATGG - Intronic
1198741566 X:139848581-139848603 CACTTGAGCCCAGGTGTTCAAGG - Intronic
1200762878 Y:7056216-7056238 CAAATGACTCGTTGGGTTCAGGG - Intronic
1200909513 Y:8517472-8517494 CATATGACCTGGGGTATTCATGG + Intergenic